scDam&T-seq

The scDam&T-seq method was originally published in Nature Biotechnology 37, 766–772. Later on, a detailed protocol was published in Nature Protocols 15, 1922–1953. The procedures in this web page is based on the Nature Protocol version.

The scDam&T-seq method is basically a clever combination of scDamID and CEL-seq to simualtaneously determine the transcriptional state and protein-DNA interaction in the same single cells.



Adapter and primer sequences:

CEL-seq2 primer: 5'- GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]TTTTTTTTTTTTTTTTTTTTTTTTV -3'

* UMI1 + UMI2 will be the final UMI (6 bp in total) for counting, and CB1 + CB2 will be the cell barcode (8 bp in total). There are 384 cell barcodes, and the sequences of the cell barcodes can be found in the Supplementary Table 1 of the Nature Protocols paper.

DamID top oligo: 5'- GGTGATCCGGTAATACGACTCACTATAGGGGTTCAGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]GA -3'

DamID bottom oligo: 5'- /5Phos/TC[4-bp CB2][3-bp UMI2][4-bp CB1][3-bp UMI1]GATCGTCGGACTGTAGAACTCTGAACCCCTATAGTGAGTCGTATTACCGGGAGCTT -3'

Prepare the DamID adaptors by annealing the DamID top and bottom oligos:


         5'- GGTGATCCGGTAATACGACTCACTATAGGGGTTCAGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]GA -3'
         3'- TTCGAGGGCCATTATGCTGAGTGATATCCCCAAGTCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]CT-/phos/ -5'

* UMI1 + UMI2 will be the final UMI (6 bp in total) for counting, and CB1 + CB2 will be the cell barcode (8 bp in total). There are 384 cell barcodes, and the sequences of the cell barcodes can be found in the Supplementary Table 2 of the Nature Protocols paper.

randomhexRT primer: 5'- GCCTTGGCACCCGAGAATTCCANNNNNN -3'

RNA PCR primer 1: 5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA -3'

RNA PCR index primer 1: 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp index]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Illumina TruSeq Small RNA Read 1 primer: 5'- GTTCAGAGTTCTACAGTCCGACGATC -3'

Illumina TruSeq Small RNA Read 2 primer: 5'- GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA -3'

Sample index sequencing primer: 5'- TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -3'



(1) Harvest cells after inducing Dam fusion protein expression, sorting cells into lysis buffer and reverse transcription in each well containing CEL-seq2 primer:


mRNA:

5'- GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](dT)V------->
                                                                                           (pA)BXXX...XXX -5'


gDNA (with protein-DNA interaction information recorded by GmATC) is unaffected at this stage:

              Me                       Me
              |                        |
5'- XXXXXXXXXGATCXXXXXXXXX...XXXXXXXXXGATCXXXXXXXXX -3'
3'- XXXXXXXXXTCAGXXXXXXXXX...XXXXXXXXXCTAGXXXXXXXXX -5'
               |                        |
               Me                       Me 

(2) Perform RNaseH and DNA pol I based second strand synthesis to conver mRNA to double stranded cDNA:


mRNA:

5'- GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](dT)VXXX...XXX -3'
3'- CGGCCATTATGCTGAGTGATATCCCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](pA)BXXX...XXX -5'


gDNA (unaffected in theory):

              Me                       Me
              |                        |
5'- XXXXXXXXXGATCXXXXXXXXX...XXXXXXXXXGATCXXXXXXXXX -3'
3'- XXXXXXXXXTCAGXXXXXXXXX...XXXXXXXXXCTAGXXXXXXXXX -5'
               |                        |
               Me                       Me 

(3) Proteinase K digenstion to remove proteins, and DpnI digestion:


mRNA (unaffected by DpnI):

5'- GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](dT)VXXX...XXX -3'
3'- CGGCCATTATGCTGAGTGATATCCCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](pA)BXXX...XXX -5'


gDNA:

              Me                        Me
              |                         |
5'- XXXXXXXXXGA TCXXXXXXXXX...XXXXXXXXXGA TCXXXXXXXXX -3'
3'- XXXXXXXXXTC AGXXXXXXXXX...XXXXXXXXXCT AGXXXXXXXXX -5'
                |                         |
                Me                        Me 

(4) Ligate the DamID adaptor to the digested DNA (methyl marks will be removed after this step for simplicity):


mRNA (I suppose the double stranded cDNA can be ligated as well, but it probably won't matter since IVT is used later. I did not draw the ligation here):

5'- GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](dT)VXXX...XXX -3'
3'- CGGCCATTATGCTGAGTGATATCCCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](pA)BXXX...XXX -5'


gDNA:

5'- GGTGATCCGGTAATACGACTCACTATAGGGGTTCAGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]GATCXXX...XXXGATC[4-bp CB2][3-bp UMI2][4-bp CB1][3-bp UMI1]GATCGTCGGACTGTAGAACTCTGAACCCCTATAGTGAGTCGTATTACCGGGAGCTT -3'
3'- TTCGAGGGCCATTATGCTGAGTGATATCCCCAAGTCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]TCAGXXX...XXXCTAG[4-bp CB2][3-bp UMI2][4-bp CB1][3-bp UMI1]CTAGCAGCCTGACATCTTGAGACTTGGGGATATCACTCAGCATAATGGCCTAGTGG -5'

(5) Pool all wells and perform in vitro transcripiton to amplify both mRNA and gDNA:


mRNA:
                      IVT starts from here
                            ↱
5'- GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](dT)VXXX...XXX -3'
3'- CGGCCATTATGCTGAGTGATATCCCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](pA)BXXX...XXX -5'


gDNA:
                           IVT starts from here
                                 ↱
5'- GGTGATCCGGTAATACGACTCACTATAGGGGTTCAGAGTTCTACAGTCCGACGATC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]GATCXXX...XXXGATC[4-bp CB2][3-bp UMI2][4-bp CB1][3-bp UMI1]GATCGTCGGACTGTAGAACTCTGAACCCCTATAGTGAGTCGTATTACCGGGAGCTT -3'
3'- TTCGAGGGCCATTATGCTGAGTGATATCCCCAAGTCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]TCAGXXX...XXXCTAG[4-bp CB2][3-bp UMI2][4-bp CB1][3-bp UMI1]CTAGCAGCCTGACATCTTGAGACTTGGGGATATCACTCAGCATAATGGCCTAGTGG -5'
                                                                                                                                                                                           ↵
                                                                                                                                                                                   IVT starts from here 

(6) Purify amplified RNA (aRNA):


Product from mRNA:

5'- GAGUUCUACAGUCCGACGAUC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](dU)VXXX...XXX -3'


Product from gDNA:

5'- GGUUCAGAGUUCUACAGUCCGACGAUC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]GATCXXX...XXXGATC[4-bp CB2][3-bp UMI2][4-bp CB1][3-bp UMI1]GAUCGUCGGACUGUAGAACUCUGAACCCCUAUAGUGAGUCGUAUUACCGGGAGCUU -3'

(7) Fragment aRNA and reverse transcription using randomhexRT pimer:


mRNA:

5'- GAGUUCUACAGUCCGACGAUC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](dU)VXXX...XXX -3'
                                                                  <------NNNNNN
                                                                               ACCTTAAGAGCCCACGGTTCCG -5'


gDNA:

5'- GGUUCAGAGUUCUACAGUCCGACGAUC[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]GATCXXX...XXXGATC[4-bp CB2][3-bp UMI2][4-bp CB1][3-bp UMI1]GAUCGUCGGACUGUAGAACUCUGAACCCCUAUAGUGAGUCGUAUUACCGGGAGCUU -3'
                                                                        <------NNNNNN
                                                                                      ACCTTAAGAGCCCACGGTTCCG -5'

(8) These are the complementary DNA after RT:


mRNA:

3'- CTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](pA)BXXX...XXXACCTTAAGAGCCCACGGTTCCG -5'


gDNA:

3'- CCAAGTCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]CTAGXXX...XXXACCTTAAGAGCCCACGGTTCCG -5'

(9) Purify and use RNA PCR primer 1 and RNA PCR index primer to amplify library:


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA------>
                                  3'- CTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2](pA)BXXX...XXXACCTTAAGAGCCCACGGTTCCG -5'
                                                                                                            <------ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG[6-bp index]TAGAGCATACGGCAGAAGACGAAC -5'

gDNA:

5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA------>
                            3'- CCAAGTCTCAAGATGTCAGGCTGCTAG[3-bp UMI1][4-bp CB1][3-bp UMI2][4-bp CB2]CTAGXXX...XXXACCTTAAGAGCCCACGGTTCCG -5'
                                                                                                           <------ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG[6-bp index]TAGAGCATACGGCAGAAGACGAAC -5'

(10) Final library structure:


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNNNNNNNN(dT)VXXX...XXXTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNNNN(pA)BXXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -3'
             Illumina P5                    RA5                UMI and          cDNA                  RA3                6-bp        Illumina P7
                                                            cell barcode                                              sample index


gDNA:

5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNNNNNNNNGATCXXX...XXXTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNNNNCTAGXXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -3'
             Illumina P5                    RA5                UMI and          gDNA                  RA3                6-bp        Illumina P7
                                                            cell barcode                                              sample index



Library sequencing (the structure of mRNA and gDNA libraries are the same, so only mRNA is shown here):

(1) Add Truseq Small RNA Read 1 (RA5) sequencing primer to sequence the first read (bottom strand as template):


                             5'- GTTCAGAGTTCTACAGTCCGACGATC------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNNNN(pA)BXXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -3'

(2) Add Sample Index sequencing primer to sequence the i7 index (bottom strand as template, 6 cycles, this is the cell barcode):


                                                                                   5'- TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNNNN(pA)BXXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -3'

(3) Cluster regeneration, add TruSeq Read 2 sequencing primer to sequence the second read (top strand as template):


5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNNNNNNNN(dT)VXXX...XXXTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                   <---ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG -5'