CEL-seq / CEL-seq2

CEL-seq2 is an improved version of CEL-seq, the main differences are:

(1) CEL-seq2 uses UMI; CEL-seq does not.

(2) CEL-seq2 uses random priming for reverse transcription after IVT amplification; CEL-seq uses RNA adapter ligation and then uses the primer annealed to the ligated adapter for reverse transcription after IVT amplification.

CEL-seq used some homemade oligo sequence design and one of Illumina's kit. The protocol in the publication was not entirely clear, so I guess it was Illumina Truseq Small RNA-seq kit based on the oligo names (In the CEL-seq2 publication, they confirmed this is the case). I still put CEL-seq here to get a historic view of how methods evolve.



CEL-seq

Adapter and primer sequences:

Barcoded RT primer: 5'- CGATTGAGGCCGGTAATACGACTCACTATAGGGGTTCAGAGTTCTACAGTCCGACGATC[8-bp cell barcode]TTTTTTTTTTTTTTTTTTTTTTTTV -3'

T7 promoter: 5'- TAATACGACTCACTATAGGG -3'

Illumina RA5 adapter (Truseq Small RNA kit): 5'- GUUCAGAGUUCUACAGUCCGACGAUC -3'

Illumina RA3 adapter (Truseq Small RNA kit): 5'- TGGAATTCTCGGGTGCCAAGG -3'

Illumina RTP primer (Truseq Small RNA kit): 5'- GCCTTGGCACCCGAGAATTCCA -3'

Illumina RP1 primer (Truseq Small RNA kit): 5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA -3'

Illumina RPI[1-48] primers (Truseq Small RNA kit): 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp RPI]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA -3'

Read 1 sequencing primer: 5'- GTTCAGAGTTCTACAGTCCGACGATC -3'

Index read primer: 5'- TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -3'

Read 2 sequencing primer: 5'- GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

6-bp RPI sequences:

     RPI1 : CGTGAT
     RPI2 : ACATCG
     RPI3 : GCCTAA
     RPI4 : TGGTCA
     RPI5 : CACTGT
     RPI6 : ATTGGC
     RPI7 : GATCTG
     RPI8 : TCAAGT
     RPI9 : CTGATC
    RPI10 : AAGCTA
    RPI11 : GTAGCC
    RPI12 : TACAAG
    RPI13 : TTGACT
    RPI14 : GGAACT
    RPI15 : TGACAT
    RPI16 : GGACGG
    RPI17 : CTCTAC
    RPI18 : GCGGAC
    RPI19 : TTTCAC
    RPI20 : GGCCAC
    RPI21 : CGAAAC
    RPI22 : CGTACG
    RPI23 : CCACTC
    RPI24 : GCTACC
    RPI25 : ATCAGT
    RPI26 : GCTCAT
    RPI27 : AGGAAT
    RPI28 : CTTTTG
    RPI29 : TAGTTG
    RPI30 : CCGGTG
    RPI31 : ATCGTG
    RPI32 : TGAGTG
    RPI33 : CGCCTG
    RPI34 : GCCATG
    RPI35 : AAAATG
    RPI36 : TGTTGG
    RPI37 : ATTCCG
    RPI38 : AGCTAG
    RPI39 : GTATAG
    RPI40 : TCTGAG
    RPI41 : GTCGTC
    RPI42 : CGATTA
    RPI43 : GCTGTA
    RPI44 : ATTATA
    RPI45 : GAATGA
    RPI46 : TCGGGA
    RPI47 : CTTCGA
    RPI48 : TGCCGA


Step-by-step library generation

(1) Anneal oligo-dT24V to mRNA and reverse transcription using MMLV:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <-----V(T)24[8-bp cell barcode]CTAGCAGCCTGACATCTTGAGACTTGGGGATATCACTCAGCATAATGGCCGGAGTTAGC -5'

(2) RNaseH and DNA Pol I based second strand synthesis:


5'- XXXXXXXXXXXXXXXXXXXB(pA)[8-bp cell barcode]GATCGTCGGACTGTAGAACTCTGAACCCCTATAGTGAGTCGTATTACCGGCCTCAATCG -3'
3'- XXXXXXXXXXXXXXXXXXXV(dT)[8-bp cell barcode]CTAGCAGCCTGACATCTTGAGACTTGGGGATATCACTCAGCATAATGGCCGGAGTTAGC -5'
                                                                        ↵
                                                                    IVT starts from here

(3) Pool cells and T7 in vitro transcription to amplify cDNA (resulting in single stranded RNA):


5'- GGUUCAGAGUUCUACAGUCCGACGAUC[8-bp cell barcode](dU)VXXX...XXX -3'

(4) Fragmentaion of amplified RNA (aRNA), ligation of Illumina RA3 adapter to aRNA. The 3' end of RA3 is probably blocked so that only one possible ligtation product is produced (3' of aRNA ligated to 5' of RA3):


5'- GGUUCAGAGUUCUACAGUCCGACGAUC[8-bp cell barcode](dU)VXXX...XXXTGGAATTCTCGGGTGCCAAGG -3'

(5) Adding Illumina RTP primer to perform reverse transcription of ligagted aRNA:


5'- GGUUCAGAGUUCUACAGUCCGACGAUC[8-bp cell barcode](dU)VXXX...XXXTGGAATTCTCGGGTGCCAAGG -3'
                                                         <------ACCTTAAGAGCCCACGGTTCCG -5'

(6) First strand cDNA of aRNA looks like this:


3'- CCAAGTCTCAAGATGTCAGGCTGCTAG[8-bp cell barcode](pA)XXX...XXXACCTTAAGAGCCCACGGTTCCG -5'

(7) Adding Illumina RP1 and PRI[1-48] primers to amplify library:


5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA--------->
                            3'- CCAAGTCTCAAGATGTCAGGCTGCTAG[8-bp cell barcode](pA)XXX...XXXACCTTAAGAGCCCACGGTTCCG -5'
                                                                                   <-------ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG[6-bp RPI]TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNN(dT)XXX...XXXTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNN(pA)XXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
             Illumina P5                    RA5              8bp         cDNA             RA3                      6bp      Illumina P7
                                                             cell                                                 sample
                                                            barcode                                               barcode



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the cell barcodes and dT):


                             5'- GTTCAGAGTTCTACAGTCCGACGATC---------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNN(pA)XXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index sequencing primer to sequence sample index (bottom strand as template):


                                                                            5'- TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNN(pA)XXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add read 2 sequencing primer to sequence read 2 (top strand as template, these are the cDNA reads):


5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNN(dT)XXX...XXXTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                        <-------ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG -5'



CEL-seq2

Adapter and primer sequences:

Barcoded RT primer: 5'- GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC[6-bp UMI][6-bp cell barcode]TTTTTTTTTTTTTTTTTTTTTTTTV -3'

T7 promoter: 5'- TAATACGACTCACTATAGGG -3'

randomhexRT primer: 5'- GCCTTGGCACCCGAGAATTCCANNNNNN -3'

Illumina RP1 primer (Truseq Small RNA kit): 5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA -3'

Illumina RPI[1-48] primers (Truseq Small RNA kit): 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp RPI]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA -3'

Read 1 sequencing primer: 5'- GTTCAGAGTTCTACAGTCCGACGATC -3'

Index read primer: 5'- TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -3'

Read 2 sequencing primer: 5'- GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step library generation

(1) Anneal oligo-dT24V to mRNA and reverse transcription using MMLV:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <-----V(T)24[6-bp cell barcode][6-bp UMI]CTAGCAGCCTGACATCTTGAGGGATATCACTCAGCATAATGGCCG -5'

(2) RNaseH and DNA Pol I based second strand synthesis:


5'- XXXXXXXXXXXXXXXXXXXB(pA)[6-bp cell barcode][6-bp UMI]GATCGTCGGACTGTAGAACTCCCTATAGTGAGTCGTATTACCGGC -3'
3'- XXXXXXXXXXXXXXXXXXXV(dT)[6-bp cell barcode][6-bp UMI]CTAGCAGCCTGACATCTTGAGGGATATCACTCAGCATAATGGCCG -5'
                                                                            ↵
                                                                    IVT starts from here

(3) Pool cells and T7 in vitro transcription to amplify cDNA (resulting in single stranded RNA):


5'- GAGUUCUACAGUCCGACGAUC[6-bp UMI][6-bp cell barcode](dU)VXXX...XXX -3'

(4) Fragmentaion of amplified RNA (aRNA), add randomhexRT primer to perform reverse transcription to convert aRNA back to cDNA:


5'- GAGUUCUACAGUCCGACGAUC[6-bp UMI][6-bp cell barcode](dU)VXXX...XXX -3'
                                                  <---------NNNNNN
                                                                  ACCTTAAGAGCCCACGGTTCCG -5'

(5) The first strand cDNA of aRNA looks like this:


3'- CTCAAGATGTCAGGCTGCTAG[6-bp UMI][6-bp cell barcode](pA)XXX...XXXACCTTAAGAGCCCACGGTTCCG -5'

(6) Adding Illumina RP1 and PRI[1-48] primers to amplify library:


5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA--------->
                                  3'- CTCAAGATGTCAGGCTGCTAG[6-bp UMI][6-bp cell barcode](pA)XXX...XXXACCTTAAGAGCCCACGGTTCCG -5'
                                                                                             <-------ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG[6-bp RPI]TAGAGCATACGGCAGAAGACGAAC -5'

(7) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNNNNNN(dT)XXX...XXXTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNN(pA)XXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
             Illumina P5                    RA5             6bp   6bp        cDNA             RA3                      6bp      Illumina P7
                                                            UMI   cell                                                sample
                                                                 barcode                                              barcode



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the UMI, cell barcodes and dT):


                             5'- GTTCAGAGTTCTACAGTCCGACGATC---------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNN(pA)XXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index sequencing primer to sequence sample index (bottom strand as template):


                                                                                5'- TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCAAGTCTCAAGATGTCAGGCTGCTAGNNNNNNNNNNNN(pA)XXX...XXXACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add read 2 sequencing primer to sequence read 2 (top strand as template, these are the cDNA reads):


5'- AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATCNNNNNNNNNNNN(dT)XXX...XXXTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                            <-------ACCTTAAGAGCCCACGGTTCCTTGAGGTCAGTG -5'