scDamID

The scDamID method was published by Kind et al. in Cell 163, 134-147. It was based on the previous method called DamID invented by Bas van Steensel and Steven Henikoff in Nature Biotechnology 18, 424–428. DamID is based on the idea that the sequence GATC occurs frequently enough in the genome, and the methylation of adenine (mA) is really really rare in higher eukaryotic cells. Well, I'm not going to comment on whether mA really exists naturally in the mammalian genomes, because I'm not an expert on this. Anyway, GmATC is really rare. The idea of DamID is very clever and simple: by tethering E. coli DNA adenine methyltransferase (Dam) to a DNA/chromatin interacting protein, Dam can be targeted in vivo to native binding sites of that protein, resulting in local DNA methylation GmATC. By using the restriction enzyme Dpn I that specifically digest GmATC, one can find out where the protein of interest is bound. scDamID optimises each reaction step and keeps each reaction in one single tube before pre-amplification. Then it just uses standard Illumina library preparation procedures (end repair - A tailing - ligation of adapter - PCR). This enables DamID at the single cell level. It is mostly used to study lamina-DNA contacts.



Adapter and primer sequences:

Illumina adaptor top: 5'- /Phos/ GATCGGAAGAGCACACGTCT -3'

Illumina adaptor bottom: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Make Illumina Y-shaped adaptors by annealing the top and the bottom sequences:


            5'- ACACTCTTTCCCTACACGAC
                                    GCTCTTCCGATCT -3'
                                    CGAGAAGGCTAG -5'
                        3'- TCTGCACA

AdRt: 5'- CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA -3'

AdRb: 5'- TCCTCGGCCG -3'

Make scDamID adaptors by annealing the AdRt and AdRb sequences:


            5'- CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA -3'
                                            3'- GCCGGCTCCT -5'


scDamID preAmp PCR primer: 5'- NNNNGTGGTCGCGGCCGAGGATC -3'

* The N at the beginning of the scDamID preAmp PCR primer means nothing. They are there just to keep Illumina sequencer happy.

Illumina PCR Primer 1.0: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T -3'

Illumina Multiplexing PCR Primer: 5'- CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Illumina TruSeq Read 1 primer: 5'- TCTTTCCCTACACGACGCTCTTCCGATCT -3'

Illumina TruSeq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Sample index sequencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'



(1) Harvest cells stably expressing Dam fusion protein, lyse cells, digest protein, and Dpn I digestion:


              Me                        Me
              |                         |
5'- XXXXXXXXXGA TCXXXXXXXXX...XXXXXXXXXGA TCXXXXXXXXX -3'
3'- XXXXXXXXXTC AGXXXXXXXXX...XXXXXXXXXCT AGXXXXXXXXX -5'
                |                         |
                Me                        Me 

(2) Ligate the scDamID adaptor to the digested DNA (methyl marks will be removed after this step for simplicity):


                                                                      Me
                                                                      |
5'- CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGATCXXXXXXXXX...XXXXXXXXXGATCCTCGGCCG -3'
                                3'- GCCGGCTCCTAGXXXXXXXXX...XXXXXXXXXCTAGGAGCCGGCGCTGGTGCGACGGGATATCACTCAGCATAATC -5'
                                              |
                                              Me

(3) Use scDamID preAmp PCR primer to amplify the ligated DNA (single primer amplification):


                     5'- NNNNGTGGTCGCGGCCGAGGATC--------->
5'- CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGATCXXXXXXXXX...XXXXXXXXXGATCCTCGGCCG -3'
                                3'- GCCGGCTCCTAGXXXXXXXXX...XXXXXXXXXCTAGGAGCCGGCGCTGGTGCGACGGGATATCACTCAGCATAATC -5'
                                                          <----------CTAGGAGCCGGCGCTGGTGNNNN -5'

(4) Purify the pre-amplified DNA and perform end repair and A-tailing:


5'-  NNNNGTGGTCGCGGCCGAGGATCXXX...XXXGATCCTCGGCCGCGACCACNNNNA -3'
3'- ANNNNCACCAGCGCCGGCTCCTAGXXX...XXXCTAGGAGCCGGCGCTGGTGNNNN  -5'

(5) Ligation of Illumina Y-shaped adaptors:


5'- ACACTCTTTCCCTACACGAC                                                                                 ACACGTCT -3'
                        GCTCTTCCGATCTNNNNGTGGTCGCGGCCGAGGATCXXX...XXXGATCCTCGGCCGCGACCACNNNNAGATCGGAAGAGC
                        CGAGAAGGCTAGANNNNCACCAGCGCCGGCTCCTAGXXX...XXXCTAGGAGCCGGCGCTGGTGNNNNTCTAGCCTTCTCG
            3'- TCTGCACA                                                                                 CAGCACATCCCTTTCTCACA -5'

(6) Amplification using Illumina PCR Primer 1.0 and Illumina Multiplexing PCR Primer. Note that in the first round, the Illumina PCR Primer 1.0 has no place to anneal to::



(i) First round (the product from the top and bottoms strands have the same structure):

Top strand:
5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGTGGTCGCGGCCGAGGATCXXX...XXXGATCCTCGGCCGCGACCACNNNNAGATCGGAAGAGCACACGTCT -3'
                                                                                 <----------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

Bottom strand:
5'- CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT------------>
                                         3'- TCTGCACACGAGAAGGCTAGANNNNCACCAGCGCCGGCTCCTAGXXX...XXXCTAGGAGCCGGCGCTGGTGNNNNTCTAGCCTTCTCGCAGCACATCCCTTTCTCACA -5'

(ii) Second round and after:

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT------------>
                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGTGGTCGCGGCCGAGGATCXXX...XXXGATCCTCGGCCGCGACCACNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG -3'
                         3'- TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNCACCAGCGCCGGCTCCTAGXXX...XXXCTAGGAGCCGGCGCTGGTGNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'
                                                                                                          <----------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(7) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGTGGTCGCGGCCGAGGATCXXX...XXXGATCCTCGGCCGCGACCACNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNCACCAGCGCCGGCTCCTAGXXX...XXXCTAGGAGCCGGCGCTGGTGNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5                    TruSeq Read 1             scDamID preAmp     gDNA      scDamID preAmp                 TruSeq Read 2           6-bp        Illumina P7
                                                                                                                                                      i7 index



Library sequencing:

(1) Add TruSeq Read 1 sequencing primer to sequence the first read (bottom strand as template):


                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT------------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNCACCAGCGCCGGCTCCTAGXXX...XXXCTAGGAGCCGGCGCTGGTGNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Sample Index sequencing primer to sequence the i7 index (bottom strand as template, 6 cycles, this is the cell barcode):


                                                                                                                 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNCACCAGCGCCGGCTCCTAGXXX...XXXCTAGGAGCCGGCGCTGGTGNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add TruSeq Read 2 sequencing primer to sequence the second read (top strand as template):


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGTGGTCGCGGCCGAGGATCXXX...XXXGATCCTCGGCCGCGACCACNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                    <----------------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'