10x Chromium Single Cell 3' V3 with Feature Barcoding

In the V3 chemistry, the oligo beads are modifidied to support feature barcoding. Each bead has three types of oligos, one for gene expression (click here to see how it works) and the other two for feature barcoding. NOTE: the cell barcodes used for RNA and Feature are different in the same drop. You need a mapping file to tell you the mapping between RNA cell barcodes and Feature cell barcodes. This file can be found from the Cellrange software. The path is cellranger-3.1.0/cellranger-cs/3.1.0/lib/python/cellranger/barcodes/3M-february-2018.txt.gz. You can also download the file here. Feature Barcoding allows you to profile surface protein abundance by using oligo-conjugated antibodies (basically CITE-seq) and CRISPR screening by capture sgRNA on top of gene expression. The antibody part is relatively easy to do and understand. I feel it is necessary to explain a bit more about the CRISPR screening part. At least I did not understand it when I first saw the kit. Now I will try to explain. I'm not an expert on CRISPR, so please correct me if I am wrong.

The sgRNA has two parts: a 17-20 nt so-called Protospacer (or just Spacer) that determines the specificity of the target, followed by a constant region called sgRNA scaffold that forms different loop structures. Your sgRNA structure is like this (picture taken from Briner et al. 2014):

sgRNA structure

Your sgRNA is often driven and transcribed by a U6 promoter from a vector backbone. There are a few different vector backbones for CRISPR screening. The exact sgRNA scaffold sequences vary among them. If you use the following backbones:

GeCKOv2 from Feng Zhang's lab, Sanjana et al., 2014, addgene #52961

Genome-wide Mouse Lentiviral CRISPR gRNA Library v1 from Kosuke Yusa's lab, Koike-Yusa et al., 2014, addgene #50946

CROP-seq from Christoph Bock's lab, Datlinger et al., 2017, addgene #86708



Then, your sgRNA scaffold sequence will be:

5'- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU -3'

and your final sgRNA transcripts will be like this:

sgRNA sequence 1

However, if you use the Perturb-seq backbone from Jonathan Weissman's lab (Adamson et al. 2016, addgene #85967), then your sgRNA scaffold sequence will be:

5'- GUUUAAGAGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU -3'

Comapring to other backbones, Perturb-seq has a slightly differnt Lower/Upper stem and Nexus sequences, and it has a very small bulge. The rest are the same as the others. Your final sgRNA transcripts will be like this:

sgRNA sequence 2

Based on the 10x guide on sgRNA, it seems they assume you are using the Perturb-seq backbone, but I guess other backbones can also work. Here, I will just use the Perturb-seq sgRNA scaffold as an example to be consistent. You need to add a sequence that is reverse complementary (rc) to the Capture Sequence that is on the V3 beads. You have two choices (pick one of them):


Capture Sequence 1 rc: 5'- GCTTTAAGGCCGGTCCTAGCAA -3'

Capture Sequence 2 rc: 5'- GCTCACCTATTAGCGGCTAAGG -3'



Okay, now, where to put that sequence? Again, in the 10x guide on sgRNA, they suggest two locations (pick one location):



Choice (1): in the first hairpin structure (called Hairpin 2 in their guide), like this:

sgRNA sequence 3

Then, you sgRNA transcripts will be one of the following two (depends on which Capture Sequence rc you pick):


5'- [Protospacer]GUUUAAGAGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGGCCGCTTTAAGGCCGGTCCTAGCAAGGCCAAGUGGCACCGAGUCGGUGCUUUUUUU -3'

5'- [Protospacer]GUUUAAGAGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGGCCGCTCACCTATTAGCGGCTAAGGGGCCAAGUGGCACCGAGUCGGUGCUUUUUUU -3'



Choice (2): just before the terminal sequence UUUUUUU, like this:

sgRNA sequence 3

Then, you sgRNA transcripts will be one of the following two (depends on which Capture Sequence rc you pick):


5'- [Protospacer]GUUUAAGAGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCGCTTTAAGGCCGGTCCTAGCAAUUUUUUU -3'

5'- [Protospacer]GUUUAAGAGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCGCTCACCTATTAGCGGCTAAGGUUUUUUU -3'



Okay, now, finally, we are ready to start the experiments ... almost. In this page, I assume you choose to insert the Capture Sequence rc to just before the terminal sequence. I feel this way is easier and safer (but both locations should work). In addition, to make things simpler, I omitted the gene expression libary construction here, because you can find that information on this page. I will also draw the surface protein profiling and CRISPR screening experiments together to make the page a bit shorter, althougth I doubt people do those two things together. If this is too confusing, I will separate them in future.



Adapter and primer sequences:

Beads-oligos (there are three types of sequences):


       TruSeq Partial Read1 dT (for mRNA):
       |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](T)30 -3'

       Nextera Partial Read1 Capture Sequence 1 (for surface protein & CRISPR screening):
       |--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC -3'

       Nextera Partial Read1 Capture Sequence 2 (for CRISPR screening):
       |--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGC -3'

Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3'

DNA oligos from the antibody: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT[random 9-mer][15-bp antibody barcodes][random 9-mer]GCTTTAAGGCCGGTCCTAGCAA -3'

sgRNA transcripts, two possiblilities depending on the capture sequence of choice (see above explanation):

   5'- [Protospacer]GUUUAAGAGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCGCTTTAAGGCCGGTCCTAGCAAUUUUUUU -3'

   5'- [Protospacer]GUUUAAGAGCUAAGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCGCTCACCTATTAGCGGCTAAGGUUUUUUU -3'



Feature cDNA Primers 1 (PN-2000096, for CRISPR screening), this is a mixture of the following 3 primers:


       Primers to amplify cDNA from mRNA:
       Forward primer: 5'- CTACACGACGCTCTTCCGATCT -3'
       Reverse primer: 5'- AAGCAGTGGTATCAACGCAGAG -3'

       Primers to amplify cDNA from sgRNA:
       Forward primer: 5'- GCAGCGTCAGATGTGTATAAGAGACAG -3'
       Reverse primer: 5'- AAGCAGTGGTATCAACGCAGAG -3'


Feature cDNA Primers 2 (PN-2000097, for surface protein), this is a mixture of the following 4 primers:


       Primers to amplify cDNA from mRNA:
       Forward primer: 5'- CTACACGACGCTCTTCCGATCT -3'
       Reverse primer: 5'- AAGCAGTGGTATCAACGCAGAG -3'

       Primers to amplify cDNA from surface protein:
       Forward primer: 5'- GCAGCGTCAGATGTGTATAAGAGACAG -3'
       Reverse primer: 5'- GTGACTGGAGTTCAGACGT -3'


Feature SI Primers 1 (PN-2000098, only used for CRISPR screening), this is a mixture of the following two primers:


       Forward primer: 5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'
       Reverse primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAGCAGTGGTATCAACGCAGAG -3'

Feature SI Primers 2 (PN-2000099): 5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Chromium i7 Sample Index (PN-220103) primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp sample index]GTGACTGGAGTTCAGACGTGT -3'

Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Illumina Nextera Read 1 primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Sample index sequencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step library generation

(1) mRNA, antibody oligo and sgRNA capture by Beads-oligos in the droplets, and reverse transcription using MMLV (MMLV has DNA-dependent DNA polymerase activity, therefore, it will reverse transcribe the antibody oligos as well even though they are DNA):


mRNA (omitted for the next step):

|--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](T)30-------->
                                                            (A)30XXXXXXXXXXXXXXXXXXXX -5'

Antibody oligos (assuming the 3' of the antibody oligo is blocked for extension):

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC-------->
                                                        3'- AACGATCCTGGCCGGAATTTCG[random 9-mer][15-bp antibody barcodes][random 9-mer]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

sgRNA:

If using Capture Sequence 1:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC-------->
                                                            AACGATCCTGGCCGGAATTTCGCGUGGCUGAGCCACGGUGAAAAAGUUCAACUAUUGCCUGAUCGGAAUAAAUUUGAACGAUACGACAAAGGUCGAAUCGAGAAUUUG[Protospacer] -5'
                                                 3'- UUUUUUU

If using Capture Sequence 2:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGC-------->
                                                            GGAATCGGCGATTATCCACTCGCGUGGCUGAGCCACGGUGAAAAAGUUCAACUAUUGCCUGAUCGGAAUAAAUUUGAACGAUACGACAAAGGUCGAAUCGAGAAUUUG[Protospacer] -5'
                                                 3'- UUUUUUU

(2) The terminal tranferase acitivity of MMLV adds extra Cs:


Antibody oligos:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC[random 9-mer][15-bp antibody barcodes][random 9-mer]AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCC -3'
                                                        3'- AACGATCCTGGCCGGAATTTCG[random 9-mer][15-bp antibody barcodes][random 9-mer]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG    -5'

sgRNA:

If using Capture Sequence 1:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCC -3'
                                                            AACGATCCTGGCCGGAATTTCGCGUGGCUGAGCCACGGUGAAAAAGUUCAACUAUUGCCUGAUCGGAAUAAAUUUGAACGAUACGACAAAGGUCGAAUCGAGAAUUUG[Protospacer]    -5'
                                                 3'- UUUUUUU

If using Capture Sequence 2:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCC -3'
                                                            GGAATCGGCGATTATCCACTCGCGUGGCUGAGCCACGGUGAAAAAGUUCAACUAUUGCCUGAUCGGAAUAAAUUUGAACGAUACGACAAAGGUCGAAUCGAGAAUUUG[Protospacer]    -5'
                                                 3'- UUUUUUU

(3) TSO for template Switching:


Antibody oligos:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC[random 9-mer][15-bp antibody barcodes][random 9-mer]AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCC----------->
                                                        3'- AACGATCCTGGCCGGAATTTCG[random 9-mer][15-bp antibody barcodes][random 9-mer]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGGGGTACATGAGACGCAACTATGGTGACGAA -5'

sgRNA:

If using Capture Sequence 1:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCC----------->
                                                            AACGATCCTGGCCGGAATTTCGCGUGGCUGAGCCACGGUGAAAAAGUUCAACUAUUGCCUGAUCGGAAUAAAUUUGAACGAUACGACAAAGGUCGAAUCGAGAAUUUG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAA -5'
                                                 3'- UUUUUUU

If using Capture Sequence 2:

|--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCC----------->
                                                            GGAATCGGCGATTATCCACTCGCGUGGCUGAGCCACGGUGAAAAAGUUCAACUAUUGCCUGAUCGGAAUAAAUUUGAACGAUACGACAAAGGUCGAAUCGAGAAUUUG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAA -5'
                                                 3'- UUUUUUU

(4) Adding Feature cDNA Primers for cDNA amplification:



(i) For surface protein profiling, add Feature cDNA Primers 2 (PN-2000097) to amplify cDNAs from mRNA (omitted here) and antibody oligos:

5'- GCAGCGTCAGATGTGTATAAGAGACAG---------------> |--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC[random 9-mer][15-bp antibody barcodes][random 9-mer]AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCCATGTACTCTGCGTTGATACCACTGCTT -3' <---------------TGCAGACTTGAGGTCAGTG -5'

(ii) For CRISPR screening, add Feature cDNA Primers 1 (PN-2000096) to amplify cDNAs from mRNA (omitted here) and sgRNA:

If using Capture Sequence 1: 5'- GCAGCGTCAGATGTGTATAAGAGACAG---------------> |--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTT -3' <----------------GAGACGCAACTATGGTGACGAA -5' If using Capture Sequence 2: 5'- GCAGCGTCAGATGTGTATAAGAGACAG---------------> |--5'- GTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTT -3' <----------------GAGACGCAACTATGGTGACGAA -5'

(5) After cDNA amplifcation, the cDNA from mRNA will be mainly >1000 bp, the cDNA from antibody oligos will be 129 bp and the cDNA from sgRNA will be ~210 bp. Separate cDNAs from mRNA and antibody oligos/sgRNA by size selection. This is the amplified cDNA products from antibody oligos and sgRNA:



(i) cDNA from antibody oligos, this is ready for library PCR:

5'- GCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC[random 9-mer][15-bp antibody barcodes][random 9-mer]AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' 3'- CGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]AACGATCCTGGCCGGAATTTCG[random 9-mer][15-bp antibody barcodes][random 9-mer]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

(ii) cDNA from sgRNA, this product needs an extra step (see the next step) before library PCR:

If using Capture Sequence 1: 5'- GCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTT -3' 3'- CGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]AACGATCCTGGCCGGAATTTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAA -5' If using Capture Sequence 2: 5'- GCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTT -3' 3'- CGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]GGAATCGGCGATTATCCACTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAA -5'

(6) Perform a Feature PCR (only needed for CRISPR screening) using Feature SI Primers 1, PN-2000098:



If using Capture Sequence 1:

5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-------------------->
                                   5'- GCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTT -3'
                                   3'- CGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]AACGATCCTGGCCGGAATTTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAA -5'
                                                                                                                                                                                                           <----------------------GAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

If using Capture Sequence 2:

5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-------------------->
                                   5'- GCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTT -3'
                                   3'- CGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]GGAATCGGCGATTATCCACTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAA -5'
                                                                                                                                                                                                           <----------------------GAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

This is the product from the above feature PCR:

If using Capture Sequence 1: 5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTTAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]AACGATCCTGGCCGGAATTTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5' If using Capture Sequence 2 (the product is exactly the same as above, except the Caputure Sequence, so this is omitted from now on): 5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]CCTTAGCCGCTAATAGGTGAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTTAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]GGAATCGGCGATTATCCACTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

(7) Add Feature SI Primers 2 (PN-2000099) and Chromium i7 Sample Index (PN-220103) for library PCR:



(i) cDNA from antibody oligos:

5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG--------------------> 5'- GCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGC[random 9-mer][15-bp antibody barcodes][random 9-mer]AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' 3'- CGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]AACGATCCTGGCCGGAATTTCG[random 9-mer][15-bp antibody barcodes][random 9-mer]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5' <-----------------TGTGCAGACTTGAGGTCAGTG[8-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'

(ii) cDNA from sgRNA:

5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG--------------------> 5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG[16-bp cell barcode][12-bp UMI]TTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC[Protospacer]CCCATGTACTCTGCGTTGATACCACTGCTTAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTC[16-bp cell barcode][12-bp UMI]AACGATCCTGGCCGGAATTTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTG[Protospacer]GGGTACATGAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5' <-----------------TGTGCAGACTTGAGGTCAGTG[8-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:

(i) mRNA library (click here to see how this is generated):


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5                   Truseq Read 1               16 bp         12 bp          cDNA          Truseq Read 2                8 bp        Illumina P7
                                                                cell barcode       UMI                                                  Sample Index

(ii) Surface protein library generated from antibody oligos, if successful, this should be 211 bp long:


5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCTAGGACCGGCCTTAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGATCCTGGCCGGAATTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5               Nextera Read 1                      16 bp         12 bp         Capture           Random    Antibody      Random          Truseq Read 2              8 bp         Illumina P7
                                                                    cell barcode       UMI         Sequence 1          9mer     barcodes       9mer                                  Sample Index

(iii) CRISPR screening library generated from sgRNA transcripts, if successful, this should be ~314 bp:


5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAACNNN...NNNCCCATGTACTCTGCGTTGATACCACTGCTTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGATCCTGGCCGGAATTTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTGNNN...NNNGGGTACATGAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -3'
          Illumina P5                   Nextera Read 1                  16 bp         12 bp         Capture                                             sgRNA scaffold                                    17-20 bp              TSO                        Truseq Read 2              8 bp         Illumina P7
                                                                    cell barcode       UMI      Sequence 1 or 2                                                                                          Protospacer                                                              Sample Index
                                                                                                                                                                                                  (sgRNA target identity)



Library sequencing:

(1) Add Read 1 primers to sequence the first read. In the Illumina sequencing kit, the Read 1 primers are a mixture of different Read 1 sequencing primers from different kits, so that you don't need to add the primers yourself (bottom strand as template, sequence 16-bp cell barcode and 12-bp UMI, 28 cycles):


(i) For mRNA (TruSeq Read 1 primer):

5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT---------------------------> 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(ii) For surface protein (Nextera Read 1 primer):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG---------------------------> 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGATCCTGGCCGGAATTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(iii) For sgRNA (Nextera Read 1 primer):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG---------------------------> 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGATCCTGGCCGGAATTTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTGNNN...NNNGGGTACATGAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -3'

(2) Add Sample Index sequencing primer to sequence the sample index (bottom strand as template, the same for all types of libraries, 8 cycles):


(i) For mRNA:

5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-------> 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(ii) For surface protein:

5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-------> 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGATCCTGGCCGGAATTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(iii) For sgRNA:

5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-------> 3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGATCCTGGCCGGAATTTCGCGTGGCTGAGCCACGGTGAAAAAGTTCAACTATTGCCTGATCGGAATAAATTTGAACGATACGACAAAGGTCGAATCGAGAATTTGNNN...NNNGGGTACATGAGACGCAACTATGGTGACGAATCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -3'

(3) Cluster regeneration, add Truseq Read 2 primer to sequence the second read (top strand as template, 98 cycles):


(i) For mRNA, these are the cDNA reads, measuring gene expression:

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3' <-------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

(ii) For surface protein, the antibody barcodes will be located from base 10 to base 24 (15-bp long), not sure whether the rest of the bases are useful, but at least you can check whether they are the bases you expected:

5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCTAGGACCGGCCTTAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3' <------------------------------------------------------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

(iii) For sgRNA, the first 30 bases will be the same, which is basically the TSO sequence, then from base 31 to base ~50 will be the identify of your sgRNA, after that, the sequences are the same again, which is the sgRNA scaffold:

5'- AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCTAGGACCGGCCTTAAAGCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAACNNN...NNNCCCATGTACTCTGCGTTGATACCACTGCTTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3' <------------------------------------------------------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'