10x Chromium Single Cell 3' Solution V2 and V3

The Chromium Single Cell 3’ Solution V2 chemistry is shown here. Oligo sequence information is taken from The 10x Genomics Technical Note. You can find out all the cell barcodes (16 bp) here: 737K-august-2016.txt. This file is copied from Cell Ranger (using Cell Ranger v2.1.0 as an example) /path/to/cellranger-2.1.0/cellranger-cs/2.1.0/tenkit/lib/python/tenkit/barcodes.

The V3 chemistry gave better sensitivity (detects more genes) comparting to the V2 chemistry. In addition, the oligo beads are modifidied to support feature barcoding. In terms of the 3' gene expression library preparation, there are only a few nucleotide differences for some oligos. The final libary structure is exactly the same, except that the UMI is 10-bp long in V2 but 12-bp in V3. The cell barcodes whitelist for the V3 chemistry can be found from the Cell Ranger software (using Cell Ranger v3.1.0 as an example): cellranger-3.1.0/cellranger-cs/3.1.0/lib/python/cellranger/barcodes/3M-february-2018.txt.gz. Oligo sequences are provided for both V2 and V3 if they are different. Only V2 library preparation is drawn here.



Adapter and primer sequences:

Beads-oligo-dT:


          V2: |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](T)30VN -3'

          V3: |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](T)30VN -3'

Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3'

cDNA Forward primer: 5'- CTACACGACGCTCTTCCGATCT -3'

cDNA Reverse primer:


          V2: 5'- AAGCAGTGGTATCAACGCAGAGTACAT -3'

          V3: 5'- AAGCAGTGGTATCAACGCAGAG -3'

Illumina Truseq Read 1 primer: 5'- TCTTTCCCTACACGACGCTCTTCCGATCT -3'

Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Truseq adapter (double stranded DNA with a T overhang):


        V2: 5'-  GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'
            3'- TCTAGCCTTCTCG -5'

        V3: 5'-  GATCGGAAGAGCACACGTCTGAACTCCAGTCA -3'
            3'- TCTAGCCTTCTCG -5'

Library PCR primer 1: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC -3'

Library PCR primer 2: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp sample index]GTGACTGGAGTTCAGACGTGT -3'

Sample index sequencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step library generation

(1) mRNA capture using Beads-oligo-dT in the droplets, and reverse transcription using MMLV:


|--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](T)30VN-------->
                                                            (A)30BXXXXXXXXXXXXXXXXXXXXX -5'

(2) The terminal tranferase acitivity of MMLV adds extra Cs:


|--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](dT)VXXXXXXXXX...XXXXXXXXXCCC -3'
                                                            (pA)BXXXXXXXXX...XXXXXXXXX    -5'

(3) Adding TSO for second strand synthesis:


|--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](dT)VXXXXXXXXX...XXXXXXXXXCCC------->
                                                   <--------(pA)BXXXXXXXXX...XXXXXXXXXGGGTACATGAGACGCAACTATGGTGACGAA    -5'

(4) Adding cDNA Forward and Reverse primers to amplify full length cDNA:


   5'- CTACACGACGCTCTTCCGATCT-------->
|--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](dT)VXXXXXXXXX...XXXXXXXXXCCCATGTACTCTGCGTTGATACCACTGCTT -3'
   3'- GATGTGCTGCGAGAAGGCTAGA[16-bp cell barcode][10-bp UMI](pA)BXXXXXXXXX...XXXXXXXXXGGGTACATGAGACGCAACTATGGTGACGAA -5'
                                                                                <--------TACATGAGACGCAACTATGGTGACGAA -5'

(5) Use Fragmentase to fragment cDNA and perform A-tailing:


Product 1 (TSO plus 5'-end of cDNA):


5'-   AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXX*A -3'
3'- A*TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXX   -5'


Product 2 (middle of cDNA):


5'-   XXXXXXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXXX*A -3'
3'- A*XXXXXXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXXX   -5'


Product 3 (Illumina Read 1 sequence, cell barcode, UMI plus 3' of cDNA):


5'-   CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](dT)VXXXXXXXXX...XXXXXXXXX*A -3'
3'- A*GATGTGCTGCGAGAAGGCTAGA[16-bp cell barcode][10-bp UMI](pA)BXXXXXXXXX...XXXXXXXXX   -5'


(6) Add double stranded Illumina Truseq adapter (with a T overhang) for ligation:


Product 1 (I assume the 5' end of TSO is blocked, so the adapter can only be ligated to the cDNA end.
This product is not amplifiable due to the use of the specific primers for amplification, see the next step):


5'-   AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'
3'- A*TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXTCTAGCCTTCTCG -5'


Product 2 (will not amplify efficiently due to semi-suppressive PCR??? not really sure about this):


5'-                      GCTCTTCCGATCTXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'
3'- CACTGACCTCAAGTCTGCACACGAGAAGGCTAGAXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXTCTAGCCTTCTCG -5'


Product 3 (I assume the 5' end of Illumina Read1 Primer is blocked, so the adapter can only be ligated
to the cDNA end. This is the only ampliable fragment):


5'-   CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'
3'- A*GATGTGCTGCGAGAAGGCTAGA[16-bp cell barcode][10-bp UMI](pA)BXXX...XXXTCTAGCCTTCTCG -5'



(7) Add Library PCR Primers 1 & 2 to amplify library:


5'-  AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC--------->
                                   5'-   CTACACGACGCTCTTCCGATCT[16-bp cell barcode][10-bp UMI](dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'
                                   3'- A*GATGTGCTGCGAGAAGGCTAGA[16-bp cell barcode][10-bp UMI](pA)BXXX...XXXTCTAGCCTTCTCG                      -5'
                                                                                                             <-----------TGTGCAGACTTGAGGTCAGTG[8-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:

V2 library:


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5                   Truseq Read 1               16 bp       10 bp          cDNA          Truseq Read 2                8 bp        Illumina P7
                                                                cell barcode     UMI                                                  Sample Index

V3 library:


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5                   Truseq Read 1               16 bp         12 bp          cDNA          Truseq Read 2                8 bp        Illumina P7
                                                                cell barcode       UMI                                                  Sample Index



Library sequencing:

(1) Add Truseq Read 1 primer to sequence the first read (bottom strand as template, sequence 16-bp cell barcode and 10-bp UMI, 26 cycles for V2, 28 cycles for V3):


                             5'- TCTTTCCCTACACGACGCTCTTCCGATCT------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Sample Index sequencing primer to sequence the sample index (bottom strand as template):


                                                                                                  5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add Truseq Read 2 primer to sequence the second read (top strand as template, sequence cDNA, 98 cycles):


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                <-----TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'