Seq-Well S3

Seq-Well S3 is an improved method over the original Seq-Well protocol. The "S3" in the name means "Second-Strand Synthesis". In the original Seq-Well workflow, the Template Switching Oligo was used for full-length cDNA synthesis and ampification, which may result in the loss of cDNAs that are partially generated (not reaching the 5' end of the gene). The new Seq-Well S3 method used random priming and primer extension for the second strand synthesis, which seems to improve the sensitivity a lot.



Adapter and primer sequences:

Beads-oligo-dT-seqB: |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3'

Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG -3'

dN-Smart Randomer (dN-SMRT): 5'- AAGCAGTGGTATCAACGCAGAGTGANNNGGNNNB -3'

Smart PCR Primer (TSO_PCR): 5′- AAGCAGTGGTATCAACGCAGAGT -3′

New-P5-SMART PCR Hybrid Oligo (P5-TSO_Hybrid):: 5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Illumina Nextera N7xx primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Custom Read 1 Primer (Read_1_Custom_SeqB): 5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

i7 index sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'



Step-by-step library generation

(1) Cell lysis, mRNA hybryidisation/capture using Beads-oligo-dT in the nanowells:


|--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)
                                                                     (pA)XXXXXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXX -5'

(2) Remove beads, reverse transcription for all cells in one reaction, the terminal tranferase acitivity of MMLV adds extra Cs, which makes the incoporation of the TSO:


TSO incorporation successful (full length cDNA):

|--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXXCCC---------->
                                                                     (pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'

TSO incorporation failed (partially generated cDNA):

|--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXXXXXXXXXXX...XXXXXXXXXXXX
                                                                     (pA)XXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXX -5'

(3) Exonuclease I treatment to remove excess oligos and NaOH denaturation to get rid of RNA:


Full-length cDNA:

|--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXXCCCATTCACTCTGCGTTGATACCACTGCTT -3'

Partial cDNA:

|--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXXXXXXXXXXX...XXXXXXXXXXXX

(4) Second strand synthesis using dN-Smart Randomer (dN-SMRT) and Klenow enzyme for the extension. Both full-length and partial cDNAs will be converted to double-stranded cDNA. Only one is drawn here:


|--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXXXXXXXXXXX...XXXXXXXXXXXXXX
                                                                              <----------BNNNGGNNN
                                                                                                  AGTGAGACGCAACTATGGTGACGAA -5'

(5) Adding Smart PCR Primer (TSO_PCR) for single primer cDNA amplification( i.e. semi-suppressive PCR ):


          5'- AAGCAGTGGTATCAACGCAGAGT---->
|--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXXVNNNCCNNNTCACTCTGCGTTGATACCACTGCTT -3'
   3'- AAAAAAATTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXBNNNGGNNNAGTGAGACGCAACTATGGTGACGAA -5'
                                                                                        <----TGAGACGCAACTATGGTGACGAA -5'

(6) Nextera tagmentation on amplified cDNA (will create 9-bp gap):

Tn5 dimer

Product 1 (5'-end of cDNA, with s5 sequence, not amplifiable due to the use of Nextera N7xx for library amplification, see step 6):


5'- AAGCAGTGGTATCAACGCAGAGTGANNNGGNNNBXXX...XXX         CTGTCTCTTATACACATCT
    TTCGTCACCATAGTTGCGTCTCACTNNNCCNNNVXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


Product 2 (5'-end of cDNA, with s7 sequence, not amplifiable due to Library PCR Primer 1 ends with "AC" which cannot to be annealed to the template, see step 6):


5'- AAGCAGTGGTATCAACGCAGAGTGANNNGGNNNBXXX...XXX         CTGTCTCTTATACACATCT
    TTCGTCACCATAGTTGCGTCTCACTNNNCCNNNVXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 3 (3'-end of cDNA, with s5 sequence, not amplifiable due to the use of Nextera N7xx for library amplification, see step 6):


5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
    TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


Product 4 (middle part of cDNA, not amplifiable due to the use of Nextera N7xx for library amplification):


  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'

  5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 5 (3'-end of cDNA, with s7 sequence, the only amplifiable fragment which will be used for library prep and sequencing, see step 6):


5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
    TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



(7) Add New-P5-SMART PCR Hybrid Oligo (P5-TSO_Hybrid) and Illumina Nextera N7xx primer for library amplification:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-------->
                                         5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
                                             TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                    <--------GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(7) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
              Illumina P5                           ISPCR/TSO           12bp cell    8bp        cDNA           ME             s7            i7          Illumina P7
                                                                         barcode     UMI



Library sequencing:

(1) Add Read 1 sequencing primer (seqA) to sequence the first read (bottom strand as template, sequence 12-bp cell barcode and 8-bp UMI):


                             5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add i7 index sequencing primer to sequence the i7 index (bottom strand as template):


                                                                                                   5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add Read 2 sequencing primer to sequence the second read (top strand as template, sequence cDNA):


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                               <-------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'