Drop-seq / Seq-Well

In the original pulication in Cell 161, 1202-1214 (2015), there are two batches of beads, with only two base pairs difference. Here, Beads-oligo-dT-seqA was used as demonstration. Seq-Well used exact the same oligo design with Drop-seq with Beads-oligo-dT-seqB, which was published in Nature Methods 14, 395–398 (2017).



Adapter and primer sequences:

Beads-oligo-dT-seqA: |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTACGT[12-bp cell barcode][8-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3'

Beads-oligo-dT-seqB: |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3'

Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG -3'

ISPCR: 5′- AAGCAGTGGTATCAACGCAGAGT -3′

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Library PCR primer 1: 5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Library PCR primer 2 (this is basically Nextera N7xx): 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Read 1 sequencing primer (seqA): 5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGT -3'

Read 1 sequencing primer (seqB): 5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

i7 index sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'



Step-by-step library generation

(1) mRNA capture using Beads-oligo-dT in the droplets:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <----NV(T)30[8-bp UMI][12-bp cell barcode]TGCATGAGACGCAACTATGGTGACGAATTTTTTTT -5'--|

(2) Break droplets (i.e. droplets are merely used as a cell capture chamber), reverse transcription for all cells in one reaction, the terminal tranferase acitivity of MMLV adds extra Cs:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
 CCCXXXXXXXXXXXXXXXXXXNV(T)30[8-bp UMI][12-bp cell barcode]TGCATGAGACGCAACTATGGTGACGAATTTTTTTT -5'--|

(3) Adding TSO for second strand synthesis:


5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGXXXXXXXXXXXXXXXXXXXX(A)n---->
                        <------CCCXXXXXXXXXXXXXXXXXXXX(T)30[8-bp UMI][12-bp cell barcode]TGCATGAGACGCAACTATGGTGACGAATTTTTTTT -5'--|

(4) Adding ISPCR for single primer cDNA amplification:( i.e. semi-suppressive PCR )


5'- AAGCAGTGGTATCAACGCAGAGT---->
5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGXXXXX...XXXXX(pA)[8-bp UMI][12-bp cell barcode]ACGTACTCTGCGTTGATACCACTGCTTAAAAAAAA
    TTCGTCACCATAGTTGCGTCTCACTTACCCXXXXX...XXXXX(dT)[8-bp UMI][12-bp cell barcode]TGCATGAGACGCAACTATGGTGACGAATTTTTTTT -5'--|
                                                                                <----TGAGACGCAACTATGGTGACGAA -5'

(5) Nextera tagmentation on amplified cDNA (will create 9-bp gap):

Tn5 dimer

Product 1 (5'-end of cDNA, with s5 sequence, not amplifiable due to the use of Nextera N7xx for library amplification, see step 6):


5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGXXX...XXX         CTGTCTCTTATACACATCT
    TTCGTCACCATAGTTGCGTCTCACTTACCCXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


Product 2 (5'-end of cDNA, with s7 sequence, not amplifiable due to Library PCR Primer 1 ends with "AC" which cannot to be annealed to the template, see step 6):


5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGXXX...XXX         CTGTCTCTTATACACATCT
    TTCGTCACCATAGTTGCGTCTCACTTACCCXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 3 (3'-end of cDNA, with s5 sequence, not amplifiable due to the use of Nextera N7xx for library amplification, see step 6):


|--5'- TTTTTTTTAAGCAGTGGTATCAACGCAGAGTACGT[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
       AAAAAAAATTCGTCACCATAGTTGCGTCTCATGCA[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


Product 4 (3'-end of cDNA, with s7 sequence, the only amplifiable fragment which will be used for library prep and sequencing, see step 6):


|--5'- TTTTTTTTAAGCAGTGGTATCAACGCAGAGTACGT[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
       AAAAAAAATTCGTCACCATAGTTGCGTCTCATGCA[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



(6) Add Library PCR Primer 1 & 2 to amplify library:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-------->
                              |--5'- TTTTTTTTAAGCAGTGGTATCAACGCAGAGTACGT[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
                                     AAAAAAAATTCGTCACCATAGTTGCGTCTCATGCA[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                      <--------GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(7) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGTNNNNNNNNNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGCANNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
              Illumina P5                           ISPCR/TSO            12bp cell     8bp        cDNA           ME             s7            i7          Illumina P7
                                                                          barcode      UMI



Library sequencing:

(1) Add Read 1 sequencing primer (seqA) to sequence the first read (bottom strand as template, sequence 12-bp cell barcode and 8-bp UMI):


                             5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGT------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGCANNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add i7 index sequencing primer to sequence the i7 index (bottom strand as template):


                                                                                                     5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGCANNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add Read 2 sequencing primer to sequence the second read (top strand as template, sequence cDNA):


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGTNNNNNNNNNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                 <-------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'