SNARE-seq

SNARE-seq was published by Chen et al. in Nature Biotechnology 37, 1452–1457. It was a droplet based technology to profile chromatin accessibility and gene expression from the same cells. The droplet beads are the same as version B of the beads from the Drop-seq method. After tagmentation, it uses a splint oligo, named "Nextera-R1-rc-polyA" to capture the tagmented open chromatin DNA to the beads. Half of the splint oligo is poly A, which is reverse complementary to the bead oligos (oligo-dT); the other half of the splint oligo is reverse complentary to the tagmentation sequence.



Adapter and primer sequences:

Beads-oligo-dT-seqB (ChemGenes, cat. no. Macosko2011-10 B): |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3'

Nextera-R1-rc-polyA: 5'-/phos/ CTGTCTCTTATACACATCTGACGCTGCCGACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -3'

Nextera-R1-bk: 5'-/phos/ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG /3InvdT/-3'

Nextera-Ad2-bk: 5'-/phos CCGAGCCCACGAGAC /3InvdT/-3'

Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG -3'

TSO PCR: 5′- AAGCAGTGGTATCAACGCAGAGT -3′

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

P5xx-TSO: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Ad2.x (this is basically Nextera N7xx): 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Read1CustomSeqB: 5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Nextera-R2 primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

i7 index sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'



Step-by-step library generation

(1) Collect cells/nuclei and Nextera tagmentation to tag open chromatin DNA. mRNA from the cytoplasma will be lost, but mRNA in the nuclei should be unaffected:

Tn5 dimer

 mRNA (unaffected):

    5'- XXXXXXXXXXXX...XXXXXXXXXXXX(pA)
 
 Open chromatin DNA product 1 (s5 at both ends:)

    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                      TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'
 
 Open chromatin DNA product 2 (s7 at both ends):

    5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                       TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
 
 Open chromatin DNA product 3 (different ends):

    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                      TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(2) Droplet encapsulation of nuclei, cell lysis, Tn5 release, mRNA capture and tagmented gDNA capture by adding the splint oligo Nextera-R1-rc-polyA (only products 1 & 3 from above will be captured):


 mRNA:

     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)
                                                                          (pA)XXXXXXXXXXXX...XXXXXXXXXXXX -5'

 Open chromatin DNA product 1:

     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                                                                      3'- (pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCp        XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'

 Open chromatin DNA product 3:

     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                                                                      3'- (pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCp        XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5' 

(3) Break droplets (i.e. droplets are merely used as a cell capture chamber), add Nextera-R1-bk and Nextera-Ad2-bk to block free oligos (not shown here), reverse transcription and ligation of chromatin DNA to the beads. Since the reverse transcription and ligation are done in the same reaction, and the reverse transcriptase has intrinsic DNA dependent DNA polymerase activity, the gaps of the captured chromatin DNA will be filled in (I think ... not entirely sure though):


 mRNA (the terminal tranferase acitivity of MMLV adds extra Cs, which allows TSO to be incoporated):

     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXXCCC----->
                                                                  <-------(pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'

Open chromatin DNA product 1:

     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX----->   CTGTCTCTTATACACATCT------>
                                                                      <---(pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCp   <----XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'

Open chromatin DNA product 3:

     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX----->   CTGTCTCTTATACACATCT------>
                                                                      <---(pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCp   <----XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5' 

(4) Note for the ATAC library, there is no phosphate at the 5' end of s5, so the top strand will have a gap. There is a phosphate at the 5' end of the Nextera-R1-rc-polyA. Therefore, the gap at the bottom strand will be filled by extension and ligation. The bottom strand will serve as the template for PCR in the next step. Thank Luciano Martelotto and Song Chen for the clarification:


 mRNA (the terminal tranferase acitivity of MMLV adds extra Cs, which allows TSO to be incoporated):

     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXXCCCATTCACTCTGCGTTGATACCACTGCTT
            AAAAAAATTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'

 Open chromatin DNA product 1 (the gap between XXXXXX and ME will be closed by the T7 ligase):

                                                                            Gap
                                                                             ↓
     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTGACGCTGCCGACGA -3'
        3'- AAAAAAATTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'
                                                                                                              ⇩⇩
                                                                                                        Gap filled by T7

 Open chromatin DNA product 3 (the gap between XXXXXX and ME will be closed by the T7 ligase):

                                                                            Gap
                                                                             ↓
     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
        3'- AAAAAAATTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5' 
                                                                                                              ⇩⇩
                                                                                                        Gap filled by T7

(5) Amplify cDNA and open chromatin using Nextera-R2 and TSO-PCR primers:


 mRNA (TSO-PCR single primer amplification):

               5'- AAGCAGTGGTATCAACGCAGAGT---------->
     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXXCCCATTCACTCTGCGTTGATACCACTGCTT
            AAAAAAATTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'
                                                                                   <----------TGAGACGCAACTATGGTGACGAA -5'

 Open chromatin DNA (only product 3 will be amplified):

               5'- AAGCAGTGGTATCAACGCAGAGT---------->
     |--5'- TTTTTTTAAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
        3'- AAAAAAATTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5' 
                                                                                                                               <----------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(6) After the above amplification, these are the products:


 mRNA:

     5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXXCCCATTCACTCTGCGTTGATACCACTGCTT -3'
     3'- TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'

 Open chromatin DNA:

     5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
     3'- TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(7) Split the amplified product into two equal half, one for cDNA, the other for open chromatin DNA amplification:


 mRNA:

     Step 1: Amplify with TSO-PCR again, 0.6X SPRI purification and perform tagmentation with Nextera XT.
             There will be a few different product after tagmentation. Only amplifiable fragment is shown here.
             Check the Drop-seq page for more details if you want to know exactly what happens here.

         5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
         3'- TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


     Step 2: Amplify the tagmented product with P5xx-TSO and Ad2.x primers:

         5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC---------->
                                                                 5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
                                                                 3'- TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                                          <----------GGCTCGGGTGCTCTG[8-bp i7 index]TAGAGCATACGGCAGAAGACGAAC -5'

 Open chromatin DNA (this is the easy part, directly amplify with P5xx-TSO and Ad2.x primers):

         5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC---------->
                                                                 5'- AAGCAGTGGTATCAACGCAGAGTAC[12-bp cell barcode][8-bp UMI](dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
                                                                 3'- TTCGTCACCATAGTTGCGTCTCATG[12-bp cell barcode][8-bp UMI](pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                                                                                    <----------GGCTCGGGTGCTCTG[8-bp i7 index]TAGAGCATACGGCAGAAGACGAAC -5'


(8) Final library structure:


 mRNA:

     5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
         TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
                   Illumina P5           i5                       ISPCR/TSO          12bp cell    8bp        cDNA           ME             s7            i7          Illumina P7
                                                                                       barcode    UMI

 Open chromatin:

     5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNN(dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
         TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
                   Illumina P5           i5                       ISPCR/TSO          12bp cell    8bp           s5               ME            gDNA           ME             s7            i7          Illumina P7
                                                                                       barcode    UMI 



Library sequencing:

(1) Add Read1CustomSeqB to sequence the first read (bottom strand as template, containing 12-bp cell barcode and 8-bp UMI):


mRNA:
                                     5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Open chromatin:
                                     5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC------------------------------------------------------------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add i7 index sequencing primer to sequence the i7 index (bottom strand as template):


mRNA:
                                                                                                           5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Open chromatin:
                                                                                                                                            5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the second index (i5) (bottom strand as template):


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Open chromatin:

5'- AATGATACGGCGACCACCGAGATCTACAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNNNNNNNNNNNNNNN(pA)AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add Nextera-R2 sequencing primer to sequence the second read (top strand as template):


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                       <-------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

Open chromatin:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNN(dT)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
                                                                                                                                        <-------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'