SMART-seq / SMART-seq2 / SMART-seq3

The protocols of SMART-seq and SMART-seq2 are almost the same. SMART-seq2 is an improved version of SMART-seq. The authors performed 457 optimisation experiments to test conditions. Two key parameters are:

(1) exchanging the last guanylate for a locked nucleic acid (LNA) at the 3' end of TSO.

(2) Include methyl group donor betaine in combination with higher MgCl2 concentrations.

SMART-seq3 is a further improvement comparing to SMART-seq/SMART-seq3, and it has a different oligo design comparing to SMART-seq/SMART-seq2. Major improvements include:

(1) Use Maxima H- reverse transcriptase.

(2) Use NaCl (instead of the common KCl) during reverse transcription.

(3) Use 5% PEG as a crowding reagent during reverse transcription, like mcSCRB-seq.

(4) Use a unique 11-bp tag and UMI in the TSO so that the 5' read can be distinguished from the internal reads.



SMART-seq / SMART-seq2

Adapter and primer sequences:

oligo-dTVN: 5'- AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'

Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrG+G -3'

ISPCR: 5′- AAGCAGTGGTATCAACGCAGAGT -3′

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Nextera (XT) N/S5xx Index primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]TCGTCGGCAGCGTC -3'

Nextera (XT) N7xx Index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Read 1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Index 1 sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

8-bp i5 & i7 sequences:

    N/S502 : CTCTCTAT
    N/S503 : TATCCTCT
    N/S505 : GTAAGGAG
    N/S506 : ACTGCATA
    N/S507 : AAGGAGTA
    N/S508 : CTAAGCCT
    N/S510 : CGTCTAAT
    N/S511 : TCTCTCCG
    N/S513 : TCGACTAG
    N/S515 : TTCTAGCT
    N/S516 : CCTAGAGT
    N/S517 : GCGTAAGA
    N/S518 : CTATTAAG
    N/S520 : AAGGCTAT
    N/S521 : GAGCCTTA
    N/S522 : TTATGCGA

    N701 : TCGCCTTA
    N702 : CTAGTACG
    N703 : TTCTGCCT
    N704 : GCTCAGGA
    N705 : AGGAGTCC
    N706 : CATGCCTA
    N707 : GTAGAGAG
    N710 : CAGCCTCG
    N711 : TGCCTCTT
    N712 : TCCTCTAC
    N714 : TCATGAGC
    N715 : CCTGAGAT
    N716 : TAGCGAGT
    N718 : GTAGCTCC
    N719 : TACTACGC
    N720 : AGGCTCCG
    N721 : GCAGCGTA
    N722 : CTGCGCAT
    N723 : GAGCGCTA
    N724 : CGCTCAGT
    N726 : GTCTTAGG
    N727 : ACTGATCG
    N728 : TAGCTGCA
    N729 : GACGTCGA


Step-by-step library generation

(1) Anneal oligo-dTVN to mRNA and reverse transcription using MMLV:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <----NV(T)30CATGAGACGCAACTATGGTGACGAA -5'

(2) After reverse transcription, the terminal tranferase acitivity of MMLV add extra Cs:


5'- XXXXXXXXXXXXXXXXXXXXB(A)n
 CCCXXXXXXXXXXXXXXXXXXXNV(T)30CATGAGACGCAACTATGGTGACGAA -5'

(3) Adding TSO for second strand synthesis:


5'- AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXXXX(A)n
                        <------CCCXXXXXXXXXXXXXXXXXXXX(T)30CATGAGACGCAACTATGGTGACGAA -5'

(4) Adding ISPCR for single primer cDNA amplification:( i.e. semi-suppressive PCR )


5'- AAGCAGTGGTATCAACGCAGAGT------>
5'- AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXX...XXXXXXX(pA)GTACTCTGCGTTGATACCACTGCTT
    TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXX...XXXXXXX(dT)CATGAGACGCAACTATGGTGACGAA -5'
                                                  <------TGAGACGCAACTATGGTGACGAA -5'

(5) Nextera tagmentation on amplified cDNA (will create 9-bp gap):

Tn5 dimer

Product 1 (s5 at both ends, not amplifiable due to semi-suppressiev PCR):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


Product 2 (s7 at both ends, not amplifiable due to semi-suppressiev PCR):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 3 (different ends, amplifiable):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(6) 72 degree gap fill-in (the first cycle in Nextera PCR):


5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
    AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(7) Amplification using N/S5xx and N7xx index primers:


5'- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC---->
                                 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
                                     AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                               <----GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXX...XXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5              i5         s5              ME                cDNA                ME               s7          i7            Illumina P7



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template):


                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add index 1 sequencing primer to sequence the first index (i7) (bottom strand as template):


                                                                                         5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the second index (i5) (bottom strand as template):


5'- AATGATACGGCGACCACCGAGATCTACAC------>
    TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, add read 2 sequencing primer to sequence the second read (top strand as template):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXX...XXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
                                                                                      <------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



SMART-seq3

Adapter and primer sequences:

Smartseq3_OligodT30VN: 5'- /5Biosg/ACGAGCATCAGCAGCATACGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'

Smartseq3_N8_TSO: 5'- /5Biosg/AGAGACAGATTGCGCAATG[8bp UMI]rGrGrG -3'

Fwd_PCR_primer: 5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAA*T*G -3′

Rev_PCR_primer: 5′- ACGAGCATCAGCAGCATAC*G*A -3′

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Nextera (XT) N/S5xx Index primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]TCGTCGGCAGCGTC -3'

Nextera (XT) N7xx Index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Read 1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Index 1 sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

8-bp i5 & i7 sequences:

    N/S502 : CTCTCTAT
    N/S503 : TATCCTCT
    N/S505 : GTAAGGAG
    N/S506 : ACTGCATA
    N/S507 : AAGGAGTA
    N/S508 : CTAAGCCT
    N/S510 : CGTCTAAT
    N/S511 : TCTCTCCG
    N/S513 : TCGACTAG
    N/S515 : TTCTAGCT
    N/S516 : CCTAGAGT
    N/S517 : GCGTAAGA
    N/S518 : CTATTAAG
    N/S520 : AAGGCTAT
    N/S521 : GAGCCTTA
    N/S522 : TTATGCGA

    N701 : TCGCCTTA
    N702 : CTAGTACG
    N703 : TTCTGCCT
    N704 : GCTCAGGA
    N705 : AGGAGTCC
    N706 : CATGCCTA
    N707 : GTAGAGAG
    N710 : CAGCCTCG
    N711 : TGCCTCTT
    N712 : TCCTCTAC
    N714 : TCATGAGC
    N715 : CCTGAGAT
    N716 : TAGCGAGT
    N718 : GTAGCTCC
    N719 : TACTACGC
    N720 : AGGCTCCG
    N721 : GCAGCGTA
    N722 : CTGCGCAT
    N723 : GAGCGCTA
    N724 : CGCTCAGT
    N726 : GTCTTAGG
    N727 : ACTGATCG
    N728 : TAGCTGCA
    N729 : GACGTCGA


Step-by-step library generation

(1) Anneal Smartseq3_OligodT30VN to mRNA and reverse transcription using Maxima H- MMLV:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <----NV(T)30AGCATACGACGACTACGAGCA -5'

(2) After reverse transcription, the terminal tranferase acitivity of MMLV add extra Cs:


5'- XXXXXXXXXXXXXXXXXXXXB(A)n
 CCCXXXXXXXXXXXXXXXXXXXNV(T)30AGCATACGACGACTACGAGCA -5'

(3) Smartseq3_N8_TSO anneals to the extra Cs for template switching:


5'- AGAGACAGATTGCGCAATG[8bp UMI]GGGXXXXXXXXXXXXXXXXXXXX(A)n
                         <------CCCXXXXXXXXXXXXXXXXXXXX(T)30AGCATACGACGACTACGAGCA -5'

(4) Adding Fwd_PCR_primer and Rev_PCR_primer for cDNA amplification:


5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG------>
                         5'- AGAGACAGATTGCGCAATG[8bp UMI]GGGXXXXXXXXXXXXXXXXXXXX(pA)TCGTATGCTGCTGATGCTCGT
                             TCTCTGTCTAACGCGTTAC[8bp UMI]CCCXXXXXXXXXXXXXXXXXXXX(dT)AGCATACGACGACTACGAGCA -5'
                                                                             <------AGCATACGACGACTACGAGCA -5'

(5) Purify amplified cDNA:


5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG[8bp UMI]GGGXXXXXXXXXXXXXXXXXXXX(pA)TCGTATGCTGCTGATGCTCGT -3'
3'- AGCAGCCGTCGCAGTCTACACATATTCTCTGTCTAACGCGTTAC[8bp UMI]CCCXXXXXXXXXXXXXXXXXXXX(dT)AGCATACGACGACTACGAGCA -5'

(6) Nextera tagmentation on amplified cDNA (will create 9-bp gap):

Tn5 dimer

Product 1 (5' fragments, s5 at both ends, not amplifiable due to semi-suppressiev PCR):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG[8bp UMI]GGGXXX...XXX         CTGTCTCTTATACACATCT
3'- AGCAGCCGTCGCAGTCTACACATATTCTCTGTCTAACGCGTTAC[8bp UMI]CCCXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


Product 2 (5' fragments, different ends, this is amplifiable):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG[8bp UMI]GGGXXX...XXX         CTGTCTCTTATACACATCT
3'- AGCAGCCGTCGCAGTCTACACATATTCTCTGTCTAACGCGTTAC[8bp UMI]CCCXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 3 (internal fragments, s5 at both ends, not amplifiable due to semi-suppressiev PCR):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


Product 4 (internal fragments, s7 at both ends, not amplifiable due to semi-suppressiev PCR):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 5 (internal fragments, different ends, this is amplifiable):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(7) 72 degree gap fill-in (the first cycle in Nextera PCR):


5' fragments:

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG[8bp UMI]GGGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
3'- AGCAGCCGTCGCAGTCTACACATATTCTCTGTCTAACGCGTTAC[8bp UMI]CCCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

Internal fragments:

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
    AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(8) Amplification using N/S5xx and N7xx index primers:


5' fragments:


5'- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC---->
                                 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG[8bp UMI]GGGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
                                 3'- AGCAGCCGTCGCAGTCTACACATATTCTCTGTCTAACGCGTTAC[8bp UMI]CCCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                      <----GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'


Internal fragments:


5'- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC---->
                                 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
                                     AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                               <----GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(9) Final library structure:


5' fragments:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATGNNNNNNNNGGGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCTAACGCGTTACNNNNNNNNCCCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5              i5         s5              ME            11 bp     8 bp       cDNA           ME               s7          i7            Illumina P7
                                                                         5' fragment   UMI
                                                                              tag


Internal fragments:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXX...XXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5              i5         s5              ME                cDNA                ME               s7          i7            Illumina P7



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, if read1 contains the 11bp 5' fragment tags, then the read pair is from the 5' of the transcript):


                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add index 1 sequencing primer to sequence the first index (i7) (bottom strand as template):


                                                                                         5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the second index (i5) (bottom strand as template, single cells can be identified by the combination of i5 and i7):


5'- AATGATACGGCGACCACCGAGATCTACAC------>
    TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, add read 2 sequencing primer to sequence the second read (top strand as template):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXX...XXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
                                                                                      <------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'