SCRB-seq / mcSCRB-seq

mcSCRB-seq is an improvement over the original SCRB-seq by using a crowding reagent during RT and other stuff. Check the manuscripts for more details. The libray construction strategy is the same.

Adapter and primer sequences:

E3V6NEXT primer: 5'-/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[6-bp cell barcode][10-bp UMI]T30VN -3'



Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'


Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'


Nextera (XT) N7xx Index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

TruSeq Read 1 sequencing primer: 5'- TCTTTCCCTACACGACGCTCTTCCGATCT -3'



Step-by-step library generation

(1) Anneal E3V6NEXT primer to mRNA and reverse transcription using MMLV:

                 <----NV(T)30[10-bp UMI][6-bp cell barcode]TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA -5'

(2) After reverse transcription, the terminal tranferase acitivity of MMLV add extra Cs:


(3) Adding E5V6NEXT primer for template switching and second strand synthesis:

                      <------CCCXXXXXXXXXXXXXXXXXXXX(T)30[10-bp UMI][6-bp cell barcode]TCTAGCCTTCTCGCAGCACATCCCTTTCTCACA -5'

(4) Adding SINGV6 primer for single primer cDNA amplification:( i.e. semi-suppressive PCR )

                                                                                          <------CGCAGCACATCCCTTTCTCACA -5'

(5) Nextera tagmentation on amplified cDNA (will create 9-bp gap):

Tn5 dimer

Product 1, 2 & 3 (middle of cDNA, Nextera adapter sequence (s5 or s7) at the ends, not amplifiable due to primer used, see the next step):




Product 4 & 5 (5' of cDNA, s5 or s7 at the other end, not amplifiable due to primer used, see the next step):



Product 5 (3' of cDNA, s5 at the other end, not amplifiable due to primer used, see the next step):


Product 6 (3' of cDNA, s7 at the other end, the only amplifiable fragment, see the next step):


(6) Amplification using P5NEXTPT5 primer and Nextera N7xx index primers:

                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT[6-bp cell barcode][10-bp UMI](dT)XXXXXX...XXXXXX         CTGTCTCTTATACACATCT
                                                                                                                                      <----GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(7) Final library structure:

           Illumina P5                  TruSeq Read 1          6bp   10bp UMI       cDNA           ME               s7          i7          Illumina P7

Library sequencing:

(1) Add TruSeq Read 1 primer to sequence the first read (bottom strand as template, this is the cell barcode and UMI):

                             5'- TCTTTCCCTACACGACGCTCTTCCGATCT--------------->

(2) Add index 1 sequencing primer to sequence the sample index (i7) (bottom strand as template):

                                                                                       5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->

(3) Cluster regeneration, add read 2 sequencing primer to sequence the second read (top strand as template, this is cDNA):

                                                                                    <------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'