Paired-seq

The Paired-seq method is developed based on the idea of combinatorial indexing stratgy that is used in sci-RNA-seq and SPLiT-seq to simultaneously tag both the open chromatin fragments generated by the Tn5 transposases and the cDNA molecules generated from reverse transcription.



Adapter and primer sequences:

*Barcoded_Tn5_top (BC#01 DNA): 5'-/5Phos/ AGGCCAGAGCATTCGAG[3-bp BC#01]GCGGCCGCAGATGTGTATAAGAGACAG -3'

ME_bottom: 5'- /5Phos/CTGTCTCTTATACACATCT/ddC/ -3'

*RT_primer (BC#01 RNA): 5'-/5Phos/ AGGCCAGAGCATTCGTC[3-bp BC#01]CCTGCAGGTTTTTTTTTTTTTTTTVN -3'

*BC#02_well_barcodes: 5'-/5Phos/ GTGCGAACTCAGACC[7-bp BC#02]ATCCACGTGCTTGAG -3'

Linker-R02: 5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'

*BC#03_well_barcodes: 5'-/5Phos/ CATCGGCGTACGACT[7-bp BC#03]GGATTCGAGGAGCGT -3'

Linker-R03: 5'- GGTCTGAGTTCGCACACGCTCCTCGAATCC -3'

*BC#04_well_barcodes: 5'- CAGACGTGTGCTCTTCCGATCT[10-bp UMI][7-bp BC#04][phase block]GTGGCCGATGTTTCG -3'

Linker-R04: 5'- AGTCGTACGCCGATGCGAAACATCGGCCAC -3'

Blocker-R02 (reverse complementary to Linker-R02): 5'- ATCCACGTGCTTGAGAGGCCAGAGCATTCG -3'

Blocker-R03 (reverse complementary to Linker-R03): 5'- GGATTCGAGGAGCGTGTGCGAACTCAGACC -3'

Terminator (reverse complementary to Linker-R04): 5'- GTGGCCGATGTTTCGCATCGGCGTACGACT -3'

Anchor: 5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGGGGGGGH -3'

PA-F: 5'- CAGACGTGTGCTCTTCCGATCT -3'

PA-R: 5'- AAGCAGTGGTATCAACGCAGAGT -3'

N5XX: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5]TCGTCGGCAGCGTC -3'

N7XX: 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC -3'

Read 1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Index 1 sequencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Read 2 sequencing primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

*There are 8 bBC#01 barcodes, 96 BC#02_well_barcodes, 96 BC#03_well_barcodes and 96 BC#04_well_barcodes. To see the full sequence details, check the Supplementary Table S1 and Supplementary Table S2 from the Paired-seq publication. PB means "phase block" which are variable length DNA bases to increase the complexity of each sequencing cycle.



Step-by-step library generation

(1) Prepare ligation adapters by annealing barcodes with correponding linkers (in three different plates):


BC#02_well_barcodes + Linker-R02:

5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'
               3'- GAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTG /Phos/-5'


BC#03_well_barcodes + Linker-R03:

5'- GGTCTGAGTTCGCACACGCTCCTCGAATCC -3'
               3'- TGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTAC /Phos/-5'


BC#04_well_barcodes + Linker-R04:

5'- AGTCGTACGCCGATGCGAAACATCGGCCAC -3'
               3'- GCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'



(2) Assemble transposase with Barcoded_Tn5_top (BC#01 DNA) and ME_bottom to tag open chromatin DNA:

Tn5 dimer

mRNA (unaffected, but cytoplasmic mRNA will probably leak out):

5'- XXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXX(pA) -3'

gDNA:

5'-/5Phos/ AGGCCAGAGCATTCGAG[3-bp BC#01]GCGGCCGCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT -3'
                                                TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGA /Phos/-5'

(3) Perform reverse transcription in situ using the nuleus as the reaction chamber with RT_primer (BC#01 RNA):


mRNA:

5'- XXX...XXXB(pA) -3'
      <---XXNV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGA /Phos/-5'

gDNA (the gap might be filled-in with RT, but not drawn here):

5'-/5Phos/ AGGCCAGAGCATTCGAG[3-bp BC#01]GCGGCCGCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT -3'
                                                TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGA /Phos/-5'

(4) Pool and distritube to BC#02 plate for ligation. Note the gDNA product is symmetric at the two ends, and eventually only the ligated strand will matter. I simply draw one end here to make it shorter:


mRNA:

5'- XXX...XXXB(pA) -3'              5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'
    XXX...XXNV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTG /Phos/-5'

gDNA:

5'- ...XXX         CTGTCTCTTATACACATCT -3'              5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'
3'- ...XXXXXXXXXXXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTG /Phos/-5'

(5) Pool and split to BC#03 plate for ligation:


mRNA:

5'- XXX...XXXB(pA) -3'              5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'    5'- GGTCTGAGTTCGCACACGCTCCTCGAATCC -3'
    XXX...XXNV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTAC /Phos/-5'

gDNA:

5'- ...XXX         CTGTCTCTTATACACATCT -3'              5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'    5'- GGTCTGAGTTCGCACACGCTCCTCGAATCC -3'
3'- ...XXXXXXXXXXXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTAC /Phos/-5'

(6) Pool and split to BC#04 plate for ligation:


mRNA:

5'- XXX...XXXB(pA) -3'              5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'    5'- GGTCTGAGTTCGCACACGCTCCTCGAATCC -3'    5'- AGTCGTACGCCGATGCGAAACATCGGCCAC -3'
    XXX...XXNV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

gDNA:

5'- ...XXX         CTGTCTCTTATACACATCT -3'              5'- CGAATGCTCTGGCCTCTCAAGCACGTGGAT -3'    5'- GGTCTGAGTTCGCACACGCTCCTCGAATCC -3'    5'- AGTCGTACGCCGATGCGAAACATCGGCCAC -3'
3'- ...XXXXXXXXXXXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(7) Pool, cell lysis, possibly get rid of the top gapped strand????.

(8) TdT for C tailing:


mRNA:

3'- CCC...CCCXXX...XXNV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'


DNA:

3'- CCC...CCCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(9) Add Anchor oligo for single primer linear amplification:


mRNA:

5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGGGGGGGH------------>
                         3'- CCC...CCCXXX...XXNV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'


DNA:

5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGGGGGGGH----------->
                         3'- CCC...CCCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(10) Purify products after linear amplification:


mRNA:

5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGGGGGGGHXX...XXXB(pA)CCTGCAGG[3-bp BC#01]GACGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
3'- TTCGTCACCATAGTTGCGTCTCACTTACCCCCCCCCXXX...XXXV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

DNA:

5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGGGGGGGHXX...XXXCTGTCTCTTATACACATCTGCGGCCGC[3-bp BC#01]CTCGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
3'- TTCGTCACCATAGTTGCGTCTCACTTACCCCCCCCCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(11) Add PA-F and PA-R for pre-amplification:


mRNA:

5'- AAGCAGTGGTATCAACGCAGAGT-------->
5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGGGGGGGHXX...XXXB(pA)CCTGCAGG[3-bp BC#01]GACGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
3'- TTCGTCACCATAGTTGCGTCTCACTTACCCCCCCCCXXX...XXXV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'
                                                                                                                                                                                                          <--------------TCTAGCCTTCTCGTGTGCAGAC -5'

DNA:

5'- AAGCAGTGGTATCAACGCAGAGT-------->
5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGGGGGGGHXX...XXXCTGTCTCTTATACACATCTGCGGCCGC[3-bp BC#01]CTCGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
3'- TTCGTCACCATAGTTGCGTCTCACTTACCCCCCCCCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'
                                                                                                                                                                                                                        <--------------TCTAGCCTTCTCGTGTGCAGAC -5'

(12) Split into two aliquot. For the RNA portion. use NotI, which cut GCGGCCGC, to digest out the DNA bit. For the DNA portion, use SbfI, which cut CCTGCAGG, to digest out the RNA bit. Then, use a Tn5-s5 homodimer to cut the product. This step is the same for both RNA and DNA portion:

Tn5 dimer

mRNA:

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXB(pA)CCTGCAGG[3-bp BC#01]GACGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                  TCTACACATATTCTCTGTC         XXX...XXXV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'


DNA:

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXCTGTCTCTTATACACATCTGCGGCCGC[3-bp BC#01]CTCGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                  TCTACACATATTCTCTGTC         XXX...XXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(13) Use N5xx and N7xx primers for library PCR:


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5]TCGTCGGCAGCGTC----------->
                                      5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXB(pA)CCTGCAGG[3-bp BC#01]GACGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                                                        TCTACACATATTCTCTGTC         XXX...XXXV(dT)GGACGTCC[3-bp BC#01]CTGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'
                                                                                                                                                                                                                                                          <-----------CTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp i7]TAGAGCATACGGCAGAAGACGAAC -5'

DNA:

5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5]TCGTCGGCAGCGTC----------->
                                      5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXCTGTCTCTTATACACATCTGCGGCCGC[3-bp BC#01]CTCGAATGCTCTGGCCTCTCAAGCACGTGGAT[7-bp BC#02]GGTCTGAGTTCGCACACGCTCCTCGAATCC[7-bp BC#03]AGTCGTACGCCGATGCGAAACATCGGCCAC[PB][7-bp BC#04][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                                                        TCTACACATATTCTCTGTC         XXX...XXXGACAGAGAATATGTGTAGACGCCGGCG[3-bp BC#01]GAGCTTACGAGACCGGAGAGTTCGTGCACCTA[7-bp BC#02]CCAGACTCAAGCGTGTGCGAGGAGCTTAGG[7-bp BC#03]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB][7-bp BC#04][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'
                                                                                                                                                                                                                                                                        <-----------CTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp i7]TAGAGCATACGGCAGAAGACGAAC -5'

(14) Final library structure:


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)CCTGCAGGNNNGACGAATGCTCTGGCCTCTCAAGCACGTGGATNNNNNNNGGTCTGAGTTCGCACACGCTCCTCGAATCCNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCAC[PB]NNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)GGACGTCCNNNCTGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
            Illumina P5          8-bp i5       s5               ME           cDNA         SbfI  3bp             linker1             7-bp             linker2             7-bp               linker3               7-bp   10bp UMI           Truseq Read 2             i7         Illumina P7
                                                                                               BC#01                                BC#02                               BC#03                                     BC#04

DNA:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTGCGGCCGCNNNCTCGAATGCTCTGGCCTCTCAAGCACGTGGATNNNNNNNGGTCTGAGTTCGCACACGCTCCTCGAATCCNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCAC[PB]NNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCGNNNGAGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
            Illumina P5          8-bp i5       s5               ME           gDNA          ME           NotI  3bp             linker1             7-bp             linker2             7-bp               linker3               7-bp   10bp UMI           Truseq Read 2             i7         Illumina P7
                                                                                                             BC#01                                BC#02                               BC#03                                     BC#04



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, 53 cycles):


mRNA:
                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG--->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)GGACGTCCNNNCTGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'


ATAC:
                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG--->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCGNNNGAGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index 1 sequencing primer to sequence i7 index (bottom strand as template, 7 cycles):


mRNA:
                                                                                                                                                                                                                              5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)GGACGTCCNNNCTGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'


ATAC:
                                                                                                                                                                                                                                            5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCGNNNGAGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'


(3) Folds over and sequence the i5 index (bottom strand as template, 8 cycles):


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACAC------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)GGACGTCCNNNCTGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'


ATAC:

5'- AATGATACGGCGACCACCGAGATCTACAC------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGACGCCGGCGNNNGAGCTTACGAGACCGGAGAGTTCGTGCACCTANNNNNNNCCAGACTCAAGCGTGTGCGAGGAGCTTAGGNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTG[PB]NNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, add Read 2 sequencing primer to sequence the cell barcodes, UMI or gDNA (top strand as template 130 cycles):


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)CCTGCAGGNNNGACGAATGCTCTGGCCTCTCAAGCACGTGGATNNNNNNNGGTCTGAGTTCGCACACGCTCCTCGAATCCNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCAC[PB]NNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                      <-------------------------------------------------------------------------------------------------------------------------------------------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'


ATAC:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTGCGGCCGCNNNCTCGAATGCTCTGGCCTCTCAAGCACGTGGATNNNNNNNGGTCTGAGTTCGCACACGCTCCTCGAATCCNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCAC[PB]NNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                              <-----------------------------------------------------------------------------------------------------------------------------------------------------------------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'