SPLiT-seq

The SPLiT-seq uses the combinatorial indexing to identify single cells without single cell isolation. Multi-level indexing can be performed by ligations. The workflow described here is based on the version 2 of the protocol (published on their google website on 30-Mar-2017, click here), and the strand blocking step is omitted here as I haven't figured out what exactly it does. Three-level indexing strategy is used in the protocol (three rounds of ligation).

There are different verrsions of the protocol, and they use slightly different oligo sequences. The basic idea of the method does not change. Check this thread for more information.



Adapter and primer sequences:

Oligo-dTVN (BC0055): 5'-/5Phos/ AGGCCAGAGCATTCGTTTTTTTTTTTTTTTVN -3'

*Round1 barcodes: 5'-/5Phos/ CGCGCTGCATACTTG[8-bp Round1 barcode]CCCATGATCGTCCGA -3'

Round1 barcode linker (BC0056): 5'- CGAATGCTCTGGCCTTCGGACGATCATGGG -3'

*Round2 barcodes: 5'-/5Phos/ CATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAG -3'

Round2 barcode linker (BC0124): 5'- CAAGTATGCAGCGCGCTCAAGCACGTGGAT -3'

*Round3 barcodes: 5'-/5Biosg/ CAGACGTGTGCTCTTCCGATCT[10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCG -3'

Round3 barcode linker (BC0060): 5'- AGTCGTACGCCGATGCGAAACATCGGCCAC -3'

Round1 blocking strand (BC0064): 5'- CCCATGATCGTCCGAAGGCCAGAGCATTCG -3'

Round2 blocking strand (BC0125): 5'- ATCCACGTGCTTGAGCGCGCTGCATACTTG -3'

Round3 blocking strand (BC0066): 5'- GTGGCCGATGTTTCGCATCGGCGTACGACT -3'

Template Switching Oligos (TSO, BC0127): 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrG+G -3'

cDNA Amplification Primer 1 (BC0062): 5'- CAGACGTGTGCTCTTCCGATCT -3'

cDNA Amplification Primer 2 (BC0108): 5'- AAGCAGTGGTATCAACGCAGAGT -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Indexed Library PCR Primer 1 (BC0076-BC0083) : 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp i7 sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Library PCR Primer 2 (BC0118): 5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Read 1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Index 1 seuencing primer: 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Read 2 sequencing primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

*Ther are 96 barcodes per round, to see the full sequence, click below:

Round1_barcodes.txt

Round2_barcodes.txt

Round3_barcodes.txt



Step-by-step library generation

(1) Prepare ligation adapters by annealing barcodes with correponding linkers (in three different plates):


Plate1: Round1 barcodes with Round1 barcode linker (BC0056):

5'- CGAATGCTCTGGCCTTCGGACGATCATGGG
                   AGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGC /5Phos/-5'


Plate2: Round2 barcodes with Round2 barcode linker (BC0124):

5'- CAAGTATGCAGCGCGCTCAAGCACGTGGAT
                   GAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTAC /5Phos/-5'


Plate3: Round3 barcodes with Round3 barcode linker (BC0060):

5'- AGTCGTACGCCGATGCGAAACATCGGCCAC
                   GCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'



(2) Anneal Oligo-dTVN primer (BC0055) to mRNA and reverse transcription using Maxima H Minus Reverse Transcriptase in situ:


5'- XXX...XXXB(A)n
        <---NV(T)15GCTTACGAGACCGGA /5Phos/-5'

(3) Distritube to Plate1 for Round1 Ligation:


5'- XXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG
 CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGC /5Phos/-5'

(4) Pool and split to Plate2 for Round2 Ligation:


5'- XXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG                     CAAGTATGCAGCGCGCTCAAGCACGTGGAT
 CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTAC /5Phos/-5'

(5) Pool and split to Plate3 for Round3 Ligation:


5'- XXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG                     CAAGTATGCAGCGCGCTCAAGCACGTGGAT                     AGTCGTACGCCGATGCGAAACATCGGCCAC
 CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'

(6) Pool, cell lysis, formamide denature DNA/RNA and bind cDNA to streptavidin beads


3'- CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'

(7) Add TSO (BC0127) for seconde strand synthesis:


5'- AAGCAGTGGTATCAACGCAGAGTGAATGGG---->
                           <---CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'--|

(8) Add cDNA Amplification Primers 1 & 2 (BC0062 and BC0108):


5'- AAGCAGTGGTATCAACGCAGAGT------>
5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGXXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
3'- TTCGTCACCATAGTTGCGTCTCACTTACCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'--|
                                                                                                                                                                                                             <------TCTAGCCTTCTCGTGTGCAGAC -5'

(9) Tagmentation with Illumina Nextera XT Kit:

Tn5 dimer

Product 1 (s5 at both ends, not amplifiable due to PCR primers used, see the next step):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'



Product 2 (s7 at both ends, not amplifiable due to PCR primers used, see the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



Product 3 (different s5 and s7 at both ends, not amplifiable, due to PCR primers used, see the next step):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 4 (s7 at one end, 3' of cDNA at the other end, not amplifiable due to PCR primers used, see the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                   TCTACACATATTCTCTGTC         XXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'


Product 5 (s5 at one end, 3' of cDNA at the other end, the only amplifiable fragment, see the next step):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                  TCTACACATATTCTCTGTC         XXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'



(10) Add Library PCR Primer 1 (one of BC0076-BC0083) and 2 (BC0018):


5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG------->
                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                                                       TCTACACATATTCTCTGTC         XXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'
                                                                                                                                                                                                                                                           <--------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(11) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGGNNNNNNNNCAAGTATGCAGCGCGCTCAAGCACGTGGATNNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCACNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGATCTAGCGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCCNNNNNNNNGTTCATACGTCGCGCGAGTTCGTGCACCTANNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTGNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
             Illumina P5                       s5               ME          cDNA               Round1 linker           8 bp           Round2 linker          8 bp          Round3 linker           8 bp    10 bp           Illumina Truseq           6bp i7      Illumina P7
                                                                                                                  Round1 barcode                        Round2 barcode                        Round3 barcode



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, cDNA reads, 60 cycles):


                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG----------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGATCTAGCGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCCNNNNNNNNGTTCATACGTCGCGCGAGTTCGTGCACCTANNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTGNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index 1 sequencing primer to sequence i7 index (bottom strand as template, 6 cycles):


                                                                                                                                                                                                                5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGATCTAGCGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCCNNNNNNNNGTTCATACGTCGCGCGAGTTCGTGCACCTANNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTGNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add Read 2 sequencing primer to sequence the second read (top strand as template, UMI and 3 rounds of barcodes, 100 cycles):


5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGGNNNNNNNNCAAGTATGCAGCGCGCTCAAGCACGTGGATNNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCACNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                               <---------------------------------------------------------------------------------------------------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'