SPLiT-seq

The SPLiT-seq uses the combinatorial indexing to identify single cells without single cell isolation. Multi-level indexing can be performed by ligations. The workflow described here is based on the version 2 of the protocol (published on their google website on 30-Mar-2017, click here), and the strand blocking step is omitted here as I haven't figured out what exactly it does. Three-level indexing strategy is used in the protocol (three rounds of ligation).



Adapter and primer sequences:

Oligo-dTVN (BC0055): 5'-/5Phos/ AGGCCAGAGCATTCGTTTTTTTTTTTTTTTVN -3'

*Round1 barcodes: 5'-/5Phos/ CGCGCTGCATACTTG[8-bp Round1 barcode]CCCATGATCGTCCGA -3'

Round1 barcode linker (BC0056): 5'- CGAATGCTCTGGCCTTCGGACGATCATGGG -3'

*Round2 barcodes: 5'-/5Phos/ CATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAG -3'

Round2 barcode linker (BC0124): 5'- CAAGTATGCAGCGCGCTCAAGCACGTGGAT -3'

*Round3 barcodes: 5'-/5Biosg/ CAGACGTGTGCTCTTCCGATCT[10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCG -3'

Round3 barcode linker (BC0060): 5'- AGTCGTACGCCGATGCGAAACATCGGCCAC -3'

Round1 blocking strand (BC0064): 5'- CCCATGATCGTCCGAAGGCCAGAGCATTCG -3'

Round2 blocking strand (BC0125): 5'- ATCCACGTGCTTGAGCGCGCTGCATACTTG -3'

Round3 blocking strand (BC0066): 5'- GTGGCCGATGTTTCGCATCGGCGTACGACT -3'

Template Switching Oligos (TSO, BC0127): 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrG+G -3'

cDNA Amplification Primer 1 (BC0062): 5'- CAGACGTGTGCTCTTCCGATCT -3'

cDNA Amplification Primer 2 (BC0108): 5'- AAGCAGTGGTATCAACGCAGAGT -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Indexed Library PCR Primer 1 (BC0076-BC0083) : 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp i7 sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Library PCR Primer 2 (BC0118): 5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Read 1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Index 1 seuencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Read 2 sequencing primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

*Ther are 96 barcodes per round, to see the full sequence, click below:

Round1_barcodes.txt

Round2_barcodes.txt

Round3_barcodes.txt



Step-by-step library generation

(1) Prepare ligation adapters by annealing barcodes with correponding linkers (in three different plates):


Plate1: Round1 barcodes with Round1 barcode linker (BC0056):

5'- CGAATGCTCTGGCCTTCGGACGATCATGGG
                   AGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGC /5Phos/-5'


Plate2: Round2 barcodes with Round2 barcode linker (BC0124):

5'- CAAGTATGCAGCGCGCTCAAGCACGTGGAT
                   GAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTAC /5Phos/-5'


Plate3: Round1 barcodes with Round3 barcode linker (BC0060):

5'- AGTCGTACGCCGATGCGAAACATCGGCCAC
                   GCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'



(2) Anneal Oligo-dTVN primer (BC0055) to mRNA and reverse transcription using Maxima H Minus Reverse Transcriptase in situ:


5'- XXX...XXXB(A)n
        <---NV(T)15GCTTACGAGACCGGA /5Phos/-5'

(3) Distritube to Plate1 for Round1 Ligation:


5'- XXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG
 CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGC /5Phos/-5'

(4) Pool and split to Plate2 for Round2 Ligation:


5'- XXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG                     CAAGTATGCAGCGCGCTCAAGCACGTGGAT
 CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTAC /5Phos/-5'

(5) Pool and split to Plate3 for Round3 Ligation:


5'- XXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG                     CAAGTATGCAGCGCGCTCAAGCACGTGGAT                     AGTCGTACGCCGATGCGAAACATCGGCCAC
 CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'

(6) Pool, cell lysis, formamide denature DNA/RNA and bind cDNA to streptavidin beads


3'- CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'

(7) Add TSO (BC0127) for seconde strand synthesis:


5'- AAGCAGTGGTATCAACGCAGAGTGAATGGG---->
                           <---CCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'--|

(8) Add cDNA Amplification Primers 1 & 2 (BC0062 and BC0108):


5'- AAGCAGTGGTATCAACGCAGAGT------>
5'- AAGCAGTGGTATCAACGCAGAGTGAATGGGXXX...XXXB(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
3'- TTCGTCACCATAGTTGCGTCTCACTTACCCXXX...XXXV(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC /5Biosg/-5'--|
                                                                                                                                                                                                             <------TCTAGCCTTCTCGTGTGCAGAC -5'

(9) Tagmentation with Illumina Nextera XT Kit:

Tn5 dimer

Product 1 (s5 at both ends, not amplifiable due to PCR primers used, see the next step):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'



Product 2 (s7 at both ends, not amplifiable due to PCR primers used, see the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



Product 3 (different s5 and s7 at both ends, not amplifiable, due to PCR primers used, see the next step):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                  TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 4 (s7 at one end, 3' of cDNA at the other end, not amplifiable due to PCR primers used, see the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                   TCTACACATATTCTCTGTC         XXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'


Product 5 (s5 at one end, 3' of cDNA at the other end, the only amplifiable fragment, see the next step):

5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                  TCTACACATATTCTCTGTC         XXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'



(10) Add Library PCR Primer 1 (one of BC0076-BC0083) and 2 (BC0018):


5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG------->
                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGG[8-bp Round1 barcode]CAAGTATGCAGCGCGCTCAAGCACGTGGAT[8-bp Round2 barcode]AGTCGTACGCCGATGCGAAACATCGGCCAC[8-bp Round3 barcode][10-bp UMI]AGATCGGAAGAGCACACGTCTG -3'
                                                       TCTACACATATTCTCTGTC         XXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCC[8-bp Round1 barcode]GTTCATACGTCGCGCGAGTTCGTGCACCTA[8-bp Round2 barcode]TCAGCATGCGGCTACGCTTTGTAGCCGGTG[8-bp Round3 barcode][10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'
                                                                                                                                                                                                                                                           <--------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(11) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGGNNNNNNNNCAAGTATGCAGCGCGCTCAAGCACGTGGATNNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCACNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGATCTAGCGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCCNNNNNNNNGTTCATACGTCGCGCGAGTTCGTGCACCTANNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTGNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
             Illumina P5                       s5               ME          cDNA               Round1 linker           8 bp           Round2 linker          8 bp          Round3 linker           8 bp    10 bp           Illumina Truseq           6bp i7      Illumina P7
                                                                                                                  Round1 barcode                        Round2 barcode                        Round3 barcode



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, cDNA reads, 60 cycles):


                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG----------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGATCTAGCGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCCNNNNNNNNGTTCATACGTCGCGCGAGTTCGTGCACCTANNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTGNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index 1 sequencing primer to sequence i7 index (bottom strand as template, 6 cycles):


                                                                                                                                                                                                               5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGATCTAGCGAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX(dT)GCTTACGAGACCGGAAGCCTGCTAGTACCCNNNNNNNNGTTCATACGTCGCGCGAGTTCGTGCACCTANNNNNNNNTCAGCATGCGGCTACGCTTTGTAGCCGGTGNNNNNNNNNNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add Read 2 sequencing primer to sequence the second read (top strand as template, UMI and 3 rounds of barcodes, 100 cycles):


5'- AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXX(pA)CGAATGCTCTGGCCTTCGGACGATCATGGGNNNNNNNNCAAGTATGCAGCGCGCTCAAGCACGTGGATNNNNNNNNAGTCGTACGCCGATGCGAAACATCGGCCACNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                               <---------------------------------------------------------------------------------------------------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'