Microwell-seq

Microwell-seq is like a well-based inDrop system. According to their Supplementary Table S2, there are two batches of beads-oligos: indexed bead seqA and indexed bead seqB. There are only two bases difference. Based on the sequence of A1-A96 in their Supplementary Table S1, it seems indexed bead seqA was used.



Adapter and primer sequences:

Sequence used during the experiment:

Indexed-Beads-seqA: |--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](T)30 -3'

Indexed-Beads-seqB: |--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTAC[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI]T30 -3'

TSO_LNA: 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG -3'

TSO_PCR: 5'- AAGCAGTGGTATCAACGCAGAGT -3'

Microwell_P5: 5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Nextera (XT) N7xx Index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Read1 SeqA-GT primer (used with Indexed-Beads-seqA): 5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGT -3'

Read1 SeqB-TAC primer (used with Indexed-Beads-seqB): 5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Illumina Nextera Index 1 sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Illunima Nextera Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

Sequence used for Indexed-Beads-seqA/B generation before the experiment:

A1-A96 (96 of them in 96 individual wells): 5'- TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG -3', for the sequences of 96 different barcode1, see Microwell_A1-A96.txt.

B1-B96 (96 of them in 96 individual wells): 5'- CGATCGTGTCACCGA[barcode2]CCCTGTAGTGAGTCG -3', for the sequences of 96 different barcode2, see Microwell_B1-B96.txt.

C1-C96 (96 of them in 96 individual wells): 5'- (A)30[6-bp UMI][barcode3]CGATCGTGTCACCGA -3', for the sequences of 96 different barcode3, see Microwell_C1-C96.txt.



Step-by-step generation of Indexed-Beads-seqA:

(1) Bind A1-A96 oligos to magnetic beads by mixing in individual wells in a 96 well plate:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG -3'

(2) Pool and split to a second 96-well plate containing B1-B96, perform PCR extention:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG---------->
                                                    <----------GCTGAGTGATGTCCC[barcode2]AGCCACTGTGCTAGC -5'

(3) This is the product after the addition of B1-B96:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG
      AAATCCCTATTGTCCCATTATTCGTCACCATAGTTGCGTCTCATGCA[barcode1]GCTGAGTGATGTCCC[barcode2]AGCCACTGTGCTAGC -5'

(4) Pooling and split to a third 96-well plate containing C1-C96: perform PCR extention


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG---------->
                                                                             <----------AGCCACTGTGCTAGC[barcode3][6-bp UMI](A)30 -5'

(5) This is the final product after all split-pool steps:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](T)30
      AAATCCCTATTGTCCCATTATTCGTCACCATAGTTGCGTCTCATGCA[barcode1]GCTGAGTGATGTCCC[barcode2]AGCCACTGTGCTAGC[barcode3][6-bp UMI](A)30 -5'

(6) Remove the bottom strand by heat to 95 C and quickly remove the supernatant (why not using NaOH here??), and the beads are ready to use:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](T)30



Step-by-step library generation

(1) Capture cells, lyse cells, anneal Indexed-Beads-seqA to mRNA, collect and pool beads and reverse transcription using MMLV inside:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](T)30---------->
                                                                                                                           (A)nXXXXXXXXX...XXXXXXXXX -5'

(2) The terminal tranferase acitivity of MMLV adds extra Cs:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](dT)XXXXXXXXX...XXXXXXXXXCCC
                                                                                                                           (pA)XXXXXXXXX...XXXXXXXXX   -5'

(3) Add TSO_LNA for template switching and second strand synthesis:


|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](dT)XXX...XXXCCC---------->
                                                                                                                <----------(pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'

(4) Add TSO_PCR for full-length cDNA amplification:


                      5'- AAGCAGTGGTATCAACGCAGAGT---------->
|--5'-TTTAGGGATAACAGGGTAATAAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](dT)XXX...XXXCCCATTCACTCTGCGTTGATACCACTGCTT
      AAATCCCTATTGTCCCATTATTCGTCACCATAGTTGCGTCTCATGCA[barcode1]GCTGAGTGATGTCCC[barcode2]AGCCACTGTGCTAGC[barcode3][6-bp UMI](pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'
                                                                                                                                    <----------TGAGACGCAACTATGGTGACGAA -5'

(5) Purfify amplified full-length double stranded cDNAs and they look like this:


5'-AAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](dT)XXX...XXXCCCATTCACTCTGCGTTGATACCACTGCTT
   TTCGTCACCATAGTTGCGTCTCATGCA[barcode1]GCTGAGTGATGTCCC[barcode2]AGCCACTGTGCTAGC[barcode3][6-bp UMI](pA)XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'

(6) Tagmentation using a transposase Tn5 with two identical insertion sequences (it was not explicitly mentioned what sequences were used in the original paper, but based on the PCR oligo sequences, it is highly likely a Tn5 homodimer with s7-ME oligo):

Tn5 dimer
Product 1: right hand side of above cDNA (5'-end transcript), not amplifiable due to primer used (see next step):


5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXCCCATTCACTCTGCGTTGATACCACTGCTT
                   TCTACACATATTCTCTGTC         XXX...XXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'



Product 2: middle of cDNA, not amplifiable due to semi-suppressive PCR:


5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



Product 3: left hand side of above cDNA (3'-end transcript), the only amplifiable fragments (see next step):


5'-AAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
   TTCGTCACCATAGTTGCGTCTCATGCA[barcode1]GCTGAGTGATGTCCC[barcode2]AGCCACTGTGCTAGC[barcode3][6-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


(7) Adding Microwell_P5 and Nextera N7xx for library amplification:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC---------->
                                          5'-AAGCAGTGGTATCAACGCAGAGTACGT[barcode1]CGACTCACTACAGGG[barcode2]TCGGTGACACGATCG[barcode3][6-bp UMI](dT)XXX...XXX         CTGTCTCTTATACACATCT
                                             TTCGTCACCATAGTTGCGTCTCATGCA[barcode1]GCTGAGTGATGTCCC[barcode2]AGCCACTGTGCTAGC[barcode3][6-bp UMI](pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                                                            <----------GGCTCGGGTGCTCTG[8-bp i7 index]TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGTNNNNNNCGACTCACTACAGGGNNNNNNTCGGTGACACGATCGNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGCANNNNNNGCTGAGTGATGTCCCNNNNNNAGCCACTGTGCTAGCNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
            Illumina P5                               TSO                6bp       linker1     6bp     linker2      6bp   6bp       cDNA           ME               s7          8bp         Illumina P7
                                                                      barcode1              barcode2             barcode3 UMI                                              sample index



Library sequencing:

(1) Add Read1 SeqA-GT primer to sequence the first read (bottom strand as template, these are the cell barcodes: the combination of barcode1/2/3):


                             5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGT----------------------------------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGCANNNNNNGCTGAGTGATGTCCCNNNNNNAGCCACTGTGCTAGCNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Illumina Nextera Index 1 sequencing primer to sequence sample index (bottom strand as template):


                                                                                                                                       5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGCANNNNNNGCTGAGTGATGTCCCNNNNNNAGCCACTGTGCTAGCNNNNNNNNNNNN(pA)XXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add Illunima Nextera Read 2 sequencing primer to sequence read 2 (top strand as template, these are the cDNA reads):


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGTNNNNNNCGACTCACTACAGGGNNNNNNTCGGTGACACGATCGNNNNNNNNNNNN(dT)XXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                                                   <-------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'