10x Chromium Single Cell Multiome ATAC + Gene Expression

This kit from 10x Genomics allows simultaneous profiling chromatin accessibility (ATAC) and gene expression (3' mRNA-seq) from the same single cells. You can think of this kit as a combination of scATAC-seq and snRNA-seq. Briefly, the nuclei were used as reaction chambers for Tn5 transposition to tag open chromatin. Then nuclei were isolated using the droplet platform, and mRNA inside the nuclei and tagged open chromatin DNA is captured by oligos on the gel beads. The workflow here is based on the revB version of the user guide at this time of writing (29-Jan-2021).

IMPORTANT NOTE: In this page, the final library strucutres are definitely correct. The intermediate steps and sequence details are based on educational guess, as 10x Genomics have not revealed it in their user guide yet.



Adapter and primer sequences:

Single Cell Multiome Gel Beads A (PN-2000261). Each individual bead has two types of oligos:


         For ATAC: |--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]CGCGTCTG -3'

          For RNA: |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'

Template Switching Oligo (TSO) (PN-3000228): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3'

Pre-Amp Primers (PN-2000271). These should be a mixture of four differen primers (fact check ????????) for pre-amplification:


          ATAC-fwd: 5'- AATGATACGGCGACCACCGAGA -3'
          ATAC-rev: 5'- GTCTCGTGGGCTCGG -3'

           RNA-fwd: 5'- CTACACGACGCTCTTCCGATCT -3'
           RNA-rev: 5'- AAGCAGTGGTATCAACGCAGAG -3'

cDNA primers (PN-2000089) which are a mixture of two oligos for cDNA amplification:


           fwd: 5'- CTACACGACGCTCTTCCGATCT -3'
           rev: 5'- AAGCAGTGGTATCAACGCAGAG -3'

SI-PCR Primer B (PN-2000128): 5'- AATGATACGGCGACCACCGAGA -3'

Sample Index Plate N, Set A (PN-3000427): 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp sample index]GTCTCGTGGGCTCGG -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step library generation

(1) Nuclei preparation and tagmentation using ATAC Enzyme B (PN-2000265). This could be a customely-made Tn5 loaded with the following scheme (fact check ????????):

Tn5 dimer

1.1) mRNA inside nuclei (unaffected):

    5'- XXXXXXXXXXXXX...XXXXXXXXAAAAA...AAAAA -3'

1.2) Open chromatin DNA (three products):

    Product 1 (different ends, the only amplifiable fragments):

        5'-         TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
        3'- GCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGA                -5'
    
    Product 2 (same ends, cannot be captured, will be omitted in the next step):

        5'-                AGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
        3'- CAGAGCACCCGAGCCTCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGA                -5'
    
    Product 3 (same ends, can be captured but cannot be amplified, will be omitted):

        5'-         TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCTGACGCTGCCGACGACAGACGCG -3'
        3'- GCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT         -5'


(2) GEM generation and barcoding inside droplet (this is the "37 degree 45mins + 25 degree 30 mins" step):


2.1) mRNA:

  2.1.1) Oligo-dT capture mRNA poly-A

     |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](T)30VN--------->
                                                             3'- (A)30BXXXXXXXXXX...XXXXXXXXXXXX -5'
  2.1.2) MMLV adds extra Cs:

     |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](T)30VXXXXXXXXXXX...XXXXXXXXXXXXCCC
                                                             3'- (A)30BXXXXXXXXXX...XXXXXXXXXXXX -5'

  2.1.3) TSO incorporation:

     |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](T)30VXXXXXXXXXXX...XXXXXXXXXXXCCC------>
                                                             3'- (A)30BXXXXXXXXXX...XXXXXXXXXXXXGGGTACATGAGACGCAACTATGGTGACGAA -5'
  2.1.4) This will be the fist strand cDNA:

     |--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](dT)VXXXXXXXXXXX...XXXXXXXXXXXCCCATGTACTCTGCGTTGATACCACTGCTT -3'


2.2) ATAC: simply beads capture and ligation (????? not entirely sure):

     |--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]CGCGTCTGTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
                                                         3'- GCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGA                -5'

(3) Post GEM Incubation Cleanup and Pre-Amplification for 7 cycles using Pre-Amp Primers (PN-2000271):


3.1) cDNA:

   5'- CTACACGACGCTCTTCCGATCT---------->
|--5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](dT)VXXXXXXXXXXX...XXXXXXXXXXXCCCATGTACTCTGCGTTGATACCACTGCTT -3'
                                                                                     <------------GAGACGCAACTATGGTGACGAA -5'

3.2) ATAC:

  3.2.1) The first step of the Pre-Amplification is the 72 degree 5 mins to fill in the gap:

     |--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]CGCGTCTGTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX--->     CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
                                               <-------------GCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTC    <----XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGA------------>

  3.2.2) 7 cycles of amplification:

        5'- AATGATACGGCGACCACCGAGA------------->
     |--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]CGCGTCTGTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
        3'- TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]GCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                     <------------GGCTCGGGTGCTCTG -5'

(4) Purification of the Pre-Amp products:


4.1) double stranded cDNA:

5'- CTACACGACGCTCTTCCGATCT[16-bp cell barcode][12-bp UMI](dT)VXXX...XXXCCCATGTACTCTGCGTTGATACCACTGCTT -3'
3'- GATGTGCTGCGAGAAGGCTAGA[16-bp cell barcode][12-bp UMI](pA)BXXX...XXXGGGTACATGAGACGCAACTATGGTGACGAA -5'

4.2) ATAC:

5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]CGCGTCTGTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]GCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(5) Split into two portions. One portion (35 ul) for Gene Expression and one (40 ul) for ATAC:


5.1) cDNA (Gene Expression):

From this step and forward, it is exactly the same as the regular 3' gene expression kit.
Follow Steps (4) to (7) of this page to see how the gene expression library is generated.

5.2) ATAC: amplify using SI-PCR Primer B (PN-2000128) and Sample Index Plate N, Set A (PN-3000427):

5'- AATGATACGGCGACCACCGAGA------------->
5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]CGCGTCTGTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]GCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                          <---------------GGCTCGGGTGCTCTG[8-bp sample index]TAGAGCATACGGCAGAAGACGAAC-5'

(6) Final library structures:


6.1) Gene Expression:

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5                   Truseq Read 1               16 bp         12 bp          cDNA          Truseq Read 2                8 bp        Illumina P7
                                                                cell barcode       UMI                                                  Sample Index

6.2) ATAC:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNCGCGTCTGTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNGCGCAGACAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5              16-bp cell    spacer      s5              ME            gDNA           ME               s7          8-bp         Illumina P7
                                      barcode                                                                                       sample index



Library sequencing is done separately:

(1) For Gene Expression: check the 10x Chromium Single Cell 3' Solution V2 and V3 page.

(2) For ATAC: check the 10x Chromium Single Cell ATAC page.