10x Chromium Single Cell 3' Solution v1

The Chromium Single Cell 3’ Solution v1 chemistry is obsolete and superseded by the v2 chemistry. I cannot find the exact sequence information from the 10x website, so sequences shown here is based on educational guess. Based on their the v1 manual PDF and actual data, I think the information in this page is accurate. You can find out all the cell barcodes (14 bp) here: 737K-april-2014_rc.txt. This file is copied from Cell Ranger (using Cell Ranger v2.1.0 as an example) /path/to/cellranger-2.1.0/cellranger-cs/2.1.0/tenkit/lib/python/tenkit/barcodes.



Adapter and primer sequences:

Beads-oligo-dT: |--5'- CAAGCAGAAGACGGCATACGAGAT[14-bp cell barcode]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT[10-bp UMI](T)30VN -3'

Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3'

ISPCR: 5′- AAGCAGTGGTATCAACGCAGAGTACAT -3′

Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Truseq adapter (double stranded DNA with a T overhang):


        5'-  TCTTTCCCTACACGACGCTCTTCCGATCT -3'
                         3'- CGAGAAGGCTAG  -5'

SI-PCR Primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp sample index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Cell barcode (i7 index) sequencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step library generation

(1) mRNA capture using Beads-oligo-dT in the droplets, and reverse transcription using MMLV:


5'- XXXXXXXXXXXXXXXXXXXXXB(A)30
               <--------NV(T)30[10-bp UMI]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[14-bp cell barcode]TAGAGCATACGGCAGAAGACGAAC -5'--|

(2) The terminal tranferase acitivity of MMLV adds extra Cs:


5'- XXXXXXXXXXXXXXXXXXXXXB(A)30
 CCCXXXXXXXXXXXXXXXXXXXXNV(T)30[10-bp UMI]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[14-bp cell barcode]TAGAGCATACGGCAGAAGACGAAC -5'--|

(3) Adding TSO for second strand synthesis:


5'- AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXXXXXB(pA)---------->
                    <----------CCCXXXXXXXXXXXXXXXXXXXXNV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[14-bp cell barcode]TAGAGCATACGGCAGAAGACGAAC -5'--|

(4) Adding ISPCR and Illumina P7 primers (this is presumably called "cDNA Primer Mix" in the PDF manual) to amplify full length cDNA:


5'- AAGCAGTGGTATCAACGCAGAGTACAT-------->
5'- AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXXXXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[14-bp cell barcode]ATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXXXXNV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[14-bp cell barcode]TAGAGCATACGGCAGAAGACGAAC -5'--|
                                                                                                                    <--------TAGAGCATACGGCAGAAGACGAAC -5'

(5) Use Covaris to shear cDNA and perform A-tailing:


Product 1 (TSO plus 5'-end of cDNA):


5'-   AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXX*A -3'
3'- A*TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXX   -5'


Product 2 (middle of cDNA):


5'-   XXXXXXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXXX*A -3'
3'- A*XXXXXXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXXX   -5'


Product 3 (3' of cDNA, UMI, Illumina Truseq Read 2 sequence, cell barcode and Illumina P7 sequence):


5'-   XXXXX...XXXXXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[14-bp cell barcode]ATCTCGTATGCCGTCTTCTGCTTG*A -3'
3'- A*XXXXX...XXXXXNV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[14-bp cell barcode]TAGAGCATACGGCAGAAGACGAAC -5'


(6) Add double stranded Illumina Truseq adapter (with a T overhang) for ligation:


Product 1 (I assume the 5' end of TSO is blocked, so the adapter can only be ligated to the cDNA end.
This product is not amplifiable due to the use of the specific primers for amplification, see the next step):


5'-   AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXAGATCGGAAGAGC -3'
3'- A*TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXTCTAGCCTTCTCGCAGCACATCCCTTTCT -5'


Product 2 (will not amplify efficiently due to semi-suppressive PCR??? not really sure about this):


5'- TCTTTCCCTACACGACGCTCTTCCGATCTXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGC -3'
3'-                 CGAGAAGGCTAGAXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXTCTAGCCTTCTCGCAGCACATCCCTTTCT -5'


Product 3 (I assume the 5' end of Illumina P7 Primer is blocked, so the adapter can only be ligated
to the cDNA end. This is the only ampliable fragment):


5'- TCTTTCCCTACACGACGCTCTTCCGATCTXXXXXX...XXXXXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[14-bp cell barcode]ATCTCGTATGCCGTCTTCTGCTTG*A -3'
3'-                 CGAGAAGGCTAGAXXXXXX...XXXXXNV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[14-bp cell barcode]TAGAGCATACGGCAGAAGACGAAC   -5'


(7) Add SI-PCR Primer and Illumina P7 Primer to index and amplify library:


5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp sample index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT--------->
                                                    5'- TCTTTCCCTACACGACGCTCTTCCGATCTXXX...XXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[14-bp cell barcode]ATCTCGTATGCCGTCTTCTGCTTG*A -3'
                                                    3'-                 CGAGAAGGCTAGAXXX...XXXV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[14-bp cell barcode]TAGAGCATACGGCAGAAGACGAAC   -5'
                                                                                                                                                        <-----------TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX...XXXB(pA)NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX...XXXV(dT)NNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5              8 bp           Truseq Read 1              cDNA          10 bp             Truseq Read 2               14 bp         Illumina P7
                               Sample Index                                                 UMI                                      cell barcode



Library sequencing:

(1) Add Truseq Read 1 primer to sequence the first read (bottom strand as template, this the cDNA read, 98 cycles):


                                     5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX...XXXV(dT)NNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Cell barcode sequencing primer to sequence the cell barcode (bottom strand as template, in this case, cell barcode = i7 index, 14 cycles):


                                                                                          5'-     AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX...XXXV(dT)NNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the sample index (i5) (bottom strand as template, 8 cycles)::


5'- AATGATACGGCGACCACCGAGATCTACAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX...XXXV(dT)NNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, add Truseq Read 2 primer to sequence the UMI (top strand as template, sequence UMI, 10 cycles):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX...XXXB(pA)NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                        <---------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'