Tang 2009

In 2009, Tang et al. presented the first method to sequence the whole transcriptome (mRNA) of a single cell in Nature Methods 6, 377–382, which marks the start of the single cell genomics era. In 2010, the authors published a detailed step-by-step protocol in Nature Protocols, 5, 516-535. This webpage is based on the Nature Protocols paper. The method was designed to be sequenced on a SOLiD sequencer, that's why the sequencing adaptors are different from other methods for Illumina.

I'm not very familiar with SOLiD sequencing, so there might be mistakes. If you spot any, please let me know.



Adapter and primer sequences:

UP1: 5'- ATATGGATCCGGCGCGCCGTCGACTTTTTTTTTTTTTTTTTTTTTTTT -3'

UP2: 5'- ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT -3'

AUP1: 5'-/NH2/ ATATGGATCCGGCGCGCCGTCGACTTTTTTTTTTTTTTTTTTTTTTTT -3'

AUP2: 5'-/NH2/ ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT -3'

P1-Adaptor upper strand: 5'- CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT -3'

P1-Adaptor lower strand: 5'- ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT -3'

Make the double stranded (ds) P1 adaptors by annealing the above P1 upper/lower sequences:


        5'-   CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT
            TTGGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTA -5'

Barcoded P2-Adaptor upper strand: 5'- CGCCTTGGCCGTACAGCAG[6-bp index]AGAGAATGAGGAACCCGGGGCAGTT -3'

Barcoded P2-Adaptor lower strand: 5'- CTGCCCCGGGTTCCTCATTCTCT[6-bp index]CTGCTGTACGGCCAAGGCG -3'

Make the double stranded (ds) P2 adaptors by annealing the above P2 upper/lower sequences:


        5'- CGCCTTGGCCGTACAGCAG[6-bp index]AGAGAATGAGGAACCCGGGGCAGTT
            GCGGAACCGGCATGTCGTC[6-bp index]TCTCTTACTCCTTGGGCCCCGTC  -5'

16Barcode Library PCR Primer-1: 5'- CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT -3'

16Barcode Library PCR Primer-2: 5'- CTGCCCCGGGTTCCTCATTCT -3'

The following Fragment library oligos are not used if you do multiplexing, so they are not included in the step-by-step library generation:

Fragment Library P1 PCR Primer: 5'- CCACTACGCCTCCGCTTTCCTCTCTATG -3'

Fragment Library P2 PCR Primer: 5'- CTGCCCCGGGTTCCTCATTCT -3'

Fragment Library P1 Adaptor 5' end: 5'- CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT -3'

Fragment Library P1 Adaptor 3' end: 5'- ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT -3'

Fragment Library P2 Adaptor 5' end: 5'- AGAGAATGAGGAACCCGGGGCAGTT -3'

Fragment Library P2 Adaptor 3' end: 5'- CTGCCCCGGGTTCCTCATTCTCT -3'



Step-by-step library generation

(1) Cell lysis, reverse transcription with UP1:


5'-  XXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXAAAAAAAAAAAAAAAAAAAAAAAA -3'
                         <----------------TTTTTTTTTTTTTTTTTTTTTTTTCAGCTGCCGCGCGGCCTAGGTATA -5'

(2) ExoI treatment to remove free primer, RNase H to remove RNA and TdT to add PolyA at the end of the cDNA:


3'- AAAAAAAAAA...AAAAAAAAAAAXXXXXXXXX...XXXXXXXXXTTTTTTTTTTTTTTTTTTTTTTTTCAGCTGCCGCGCGGCCTAGGTATA -5'

(3) Second strand synthesis with the UP2 primer:


5'- ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-------------->
                 <----------AAAAAAAAAA...AAAAAAAAAAAXXXXXXXXX...XXXXXXXXXTTTTTTTTTTTTTTTTTTTTTTTTCAGCTGCCGCGCGGCCTAGGTATA -5'

(4) PCR amplification of the double stranded cDNA with UP1 and UP2 primers:


5'- ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT------>
5'- ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTTXXX...XXXAAAAAAAAAAAAAAAAAAAAAAAAGTCGACGGCGCGCCGGATCCATAT
    TATAGAGCTCCCGCGCGGCCTAGGAAAAAAAAAA...AAAAAAAAAAAXXX...XXXTTTTTTTTTTTTTTTTTTTTTTTTCAGCTGCCGCGCGGCCTAGGTATA -5'
                                                     <-------TTTTTTTTTTTTTTTTTTTTTTTTCAGCTGCCGCGCGGCCTAGGTATA -5'

(5) cDNA purification and perform 2nd amplification using AUP1 and AUP2:


5'-/NH2/ ATATCTCGAGGGCGCGCCGGATCC(dT)------>
     5'- ATATCTCGAGGGCGCGCCGGATCC(dT)XXX...XXX(pA)GTCGACGGCGCGCCGGATCCATAT
         TATAGAGCTCCCGCGCGGCCTAGG(pA)XXX...XXX(dT)CAGCTGCCGCGCGGCCTAGGTATA -5'
                                      <-------(dT)CAGCTGCCGCGCGGCCTAGGTATA /NH2/-5'

(5) cDNA purification, fragmentation, end repair with the End-It kit (the end of the fragments are blocked by NH2, which prevents ligation, so I will only draw the middle parts of cDNA):


5'- XXXXXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXX -3'
3'- XXXXXXXXXXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXXXXXXXXXX -5'

(6) Ligation of ds P1 and ds P2 adaptors to the fragmented cDNA (I guess this is blunt end ligation, and there are probably three products, not entirely sure here):


 Product 1 (P1 at both ends, probably not amplifiable):

  5'-   CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATXXX...XXXATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT -3'
  3'- TTGGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTAXXX...XXXTAGTGGCTGACGGGTATCTCTCCTTTCGCCTCCGCATCACC -5'

 Product 2 (P2 at both ends, probably not amplifiable):
  
  5'-   CTGCCCCGGGTTCCTCATTCTCT[6-bp index]CTGCTGTACGGCCAAGGCGXXX...XXXCGCCTTGGCCGTACAGCAG[6-bp index]AGAGAATGAGGAACCCGGGGCAGTT -3'
  3'- TTGACGGGGCCCAAGGAGTAAGAGA[6-bp index]GACGACATGCCGGTTCCGCXXX...XXXGCGGAACCGGCATGTCGTC[6-bp index]TCTCTTACTCCTTGGGCCCCGTC -5'

 Product 3 (I guess this is the proper fragment with P1 and P2):

  5'-   CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATXXX...XXXCGCCTTGGCCGTACAGCAG[6-bp index]AGAGAATGAGGAACCCGGGGCAGTT -3'
  3'- TTGGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTAXXX...XXXGCGGAACCGGCATGTCGTC[6-bp index]TCTCTTACTCCTTGGGCCCCGTC -5'

(7) Nick translation and library amplification using 16Barcode Library PCR Primer-1 & 2:


  5'- CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT------>
5'-   CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATXXX...XXXCGCCTTGGCCGTACAGCAG[6-bp index]AGAGAATGAGGAACCCGGGGCAGTT -3'
3'- TTGGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTAXXX...XXXGCGGAACCGGCATGTCGTC[6-bp index]TCTCTTACTCCTTGGGCCCCGTC -5'
                                                                               <---------TCTTACTCCTTGGGCCCCGTC -5'

(8) Final library structure:


5'- CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATXXX...XXXCGCCTTGGCCGTACAGCAGNNNNNNAGAGAATGAGGAACCCGGGGCAG -3'
3'- GGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTAXXX...XXXGCGGAACCGGCATGTCGTCNNNNNNTCTCTTACTCCTTGGGCCCCGTC -5'
               SOLiD P1 adaptor                cDNA          SOLiD barcoded P2 adaptor



Library sequencing:


 SOLiD sequencing. You can Google SOLiD sequencing by ligation for details.