scifi-RNA-seq

The single-cell combinatorial fluidic indexing RNA-seq (scifi-RNA-seq) uses similar strategy as the sci-RNA-seq, where combinatorial indexing strategy is used. The difference is after in situ reverse transcription with barcoded oligo-dT primers, cells are loaded onto the 10x Chromium system. Cells are overloaded so that >95% of the droplets contain at least one cells. Single cells can be identified by the combination of the RT barcodes and the 10x barcodes. The interesting thing is that the author uses the 10x Chromium scATAC-seq kit for the experiments. This page is basically a recreation of the Supplementary Figure 2 from their manuscript.



Adapter and primer sequences:

SCIFI_LIG384_{001..384}: 5'- /Phos/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN

* There are a tolal of 384 barcodes. Check the Supplementary Table 1 from the manuscript for a full list.

Beads-oligo: |--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp bead barcode]TCGTCGGCAGCGTC -3'

Bridge-Oligo_truseq_ddC: 5'- CGTCGTGTAGGGAAAGAGTGTGACGCTGCCGACGA[ddC] -3'

Template-Switching-Oligo(TSO): 5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG -3'

Partial P5: 5'- AATGATACGGCGACCACCGAGA -3'

TSO_enrichment_primer: 5'- AAGCAGTGGTATCAACGCAGAGT -3'

Nextera N7 index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG -3'

Nextera left primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera right primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Illumina Nextera Read 2 primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

Sample index sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step library generation

(1) In situ reverse transcription to index transcripts of bulk cells in individual wells:


5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](T)30VN-------------->
                                                                 (A)n BXXXXXXXXXXXXXXXXX -5'

(2) After reverse transcription, the terminal tranferase acitivity of MMLV add extra Cs:


5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXXXXX...XXXXXXCCC
                                                                 (pA)BXXXXXX...XXXXXX -5'

(3) Pool nulcei from all wells and load them together with the Bridge-Oligo_truseq_ddC onto the 10x Chromium chip with scATAC-seq beads for ligation to capture cDNA to the gel beads:


|--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXXXXX...XXXXXXCCC -3'
                                                       CAGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGC

(4) Break the emulsion, purify the cDNA, add TSO for template switching:


5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXXXXX...XXXXXXCCC-------->
                                                                                                                                                    GGGTAAGTGAGACGCAACTATGGTGACGAA -5'

(5) Purify the product by SPRI beads:


5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXXXXX...XXXXXXCCCATTCACTCTGCGTTGATACCACTGCTT -3'
                                                                                                                                                    GGGTAAGTGAGACGCAACTATGGTGACGAA -5'

(6) Amplify cDNA using the Partial_P5 and TSO_enrichment_primer:


5'- AATGATACGGCGACCACCGAGA------------>
5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXXXXX...XXXXXXCCCATTCACTCTGCGTTGATACCACTGCTT -3'
                                                                                                                                                    GGGTAAGTGAGACGCAACTATGGTGACGAA -5'
                                                                                                                                            <--------------TGAGACGCAACTATGGTGACGAA -5'

(7) Purify the amplified cDNA:


5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXXXXX...XXXXXXCCCATTCACTCTGCGTTGATACCACTGCTT -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]AGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA[8-bp UMI][13-bp RT barcode](pA)BXXXXXX...XXXXXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'

(8) Tagmentation on the cDNA using a Tn5 homodimer:

Tn5 dimer

There are 3 different products after tagmentation (will create 9 bp gap):


Product 1 (The same ends, not amplifiable due to primers used later in the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 2 (right part of the above cDNA, not amplifiable due to primers used later in the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCCCATTCACTCTGCGTTGATACCACTGCTT -3'
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGGGTAAGTGAGACGCAACTATGGTGACGAA -5'


Product 3 (left part of the above cDNA, amplifiable):

5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXX...XXX         CTGTCTCTTATACACATCT
3'- TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]AGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA[8-bp UMI][13-bp RT barcode](pA)BXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(9) Amplify the library using the Partial_P5 and Nextera N7 index primers:


5'- AATGATACGGCGACCACCGAGA------------>
5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT[8-bp UMI][13-bp RT barcode](dT)VXXX...XXX         CTGTCTCTTATACACATCT
3'- TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]AGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA[8-bp UMI][13-bp RT barcode](pA)BXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                                           <--------------GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(10) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNV(dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNB(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5              16-bp bead         s5              TruSeq Read 1              8-bp    13-bp RT           cDNA           ME               s7       8-bp i7        Illumina P7
                                      barcode                                                      UMI     barcode                                                  sample index



Library sequencing:

(1) Add TruSeq Read 1 primer to sequence the first read (bottom strand as template, 21 cycles, these are UMI + RT barcode):


                                                           5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT-------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNB(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Sample Index sequencing primer to sequence the i7 sample index (bottom strand as template, 8 cycles):


                                                                                                                               5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNB(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the second index (i5) (bottom strand as template, 16 cycles, this is bead barcode. Single cells can be identified by the combination of bead barcodes and RT barcodes):


5'- AATGATACGGCGACCACCGAGATCTACAC--------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNB(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, add Nextera Read 2 primer to sequence the second read (top strand as template, 47 cycles, cDNA reads):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNV(dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                                            <------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'