sci-RNA-seq3

The sci-RNA-seq3 is an updated version of sci-RNA-seq. The major improvements are:

(1) nuclei are extracted directly from fresh tissues without enzymatic treatment;

(2) hairpin ligation for the third level indexing (barcoded Tn5 tagmentation was used in the previous version);

(3) individually optimised enzymatic reactions;

(4) FACS was replaced by dilution, and sonication and filtration steps were added to minimize aggregation.



Adapter and primer sequences:

Barcoded RT primer: 5'- /Phos/CAGAGC[8-bp UMI][10-bp RT barcode]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'

* There are 384 barcoded RT primers, click here to see the full sequence.

Barcoded hairpin adapters: 5'- GCTCTG[9-bp or 10-bp barcode A]/ddU/ACGACGCTCTTCCGATCT[reverse complement of barcode A] -3'

* There are 384 barcoded hairpin adapters, click here to see the full sequence. The structure of these adapters is like this:


         CTTCCGATCT
        /          NNNNNNNNNN -3'
        |          NNNNNNNNNNGTCTCG -5'
        TCGCAGCAddU

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

PCR P5 Primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

* There are 96 barcoded P5 primers, click here to see the full sequence.

PCR P7 Primer: 5'- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG -3'

* There are 96 barcoded P7 primers, click here to see the full sequence.

Read 1 sequencing primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Index 1 sequencing primer (i7): 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Read 2 seuquencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'



Step-by-step library generation

(1) Anneal Barcoded RT primer to mRNA in fixed cells and reverse transcription using MMLV in situ:


5'- CAGAGC[8-bp UMI][10-bp RT barcode](T)30VN---------->
                                      (A)n BXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX -5'

(2) Pool all wells, and re-distribute into wells in a new plate, and ligate barcoded hairpin adapters:


 CTTCCGATCT
/          NNNNNNNNNNCAGAGC[8-bp UMI][10-bp RT barcode](dT)VXXXXXXXXXXXXXXXXXXXXXXX -3'
|          NNNNNNNNNNGTCTCG -5'                        (pA)BXXXXXXXXXXXXXXXXXXXXXXX -5'
TCGCAGCAddU

(3) Pool all wells again, and re-distribute into wells in a new plate, and perform RNaseH and DNA Pol I based second strand synthesis. DNA Pol I has strand displacement activity, so the hairpin structure is destroyed during the sencond strand synthesis:


5'- GCTCTGNNNNNNNNNN/ddU/ACGACGCTCTTCCGATCTNNNNNNNNNNCAGAGC[8-bp UMI][10-bp RT barcode](dT)VXXXXXXXXXXXXXXXXXXXXXXX -3'
3'- CGAGACNNNNNNNNNN  A  TGCTGCGAGAAGGCTAGANNNNNNNNNNGTCTCG[8-bp UMI][10-bp RT barcode](pA)BXXXXXXXXXXXXXXXXXXXXXXX -5'

(4) Perform tagmentation using a Tn5 homodimer with s7-ME oligo (will create 9-bp gap):

Tn5 dimer

Product 1 (s7 at both ends, not amplifiable due to the use of Illumina P5/P7 Primer, see the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



Product 2 (s7 at one end, 3' of cDNA at the other end, the only amplifiable product, see the next step):

5'- GCTCTGNNNNNNNNNN/ddU/ACGACGCTCTTCCGATCTNNNNNNNNNNCAGAGC[8-bp UMI][10-bp RT barcode](dT)VXXX...XXX         CTGTCTCTTATACACATCT -3'
3'- CGAGACNNNNNNNNNN  A  TGCTGCGAGAAGGCTAGANNNNNNNNNNGTCTCG[8-bp UMI][10-bp RT barcode](pA)BXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


(5) NEB USER Enzyme treatment to destroy the uracil base (ddU):


5'- GCTCTGNNNNNNNNNN ACGACGCTCTTCCGATCTNNNNNNNNNNCAGAGC[8-bp UMI][10-bp RT barcode](dT)VXXX...XXX         CTGTCTCTTATACACATCT -3'
3'- CGAGACNNNNNNNNNNATGCTGCGAGAAGGCTAGANNNNNNNNNNGTCTCG[8-bp UMI][10-bp RT barcode](pA)BXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(6) Adding PCR P5/P7 Primers for library amplification:


5'- AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTAC
                                                    ACGACGCTCTTCCGATCT------>
                               5'- GCTCTGNNNNNNNNNN ACGACGCTCTTCCGATCTNNNNNNNNNNCAGAGC[8-bp UMI][10-bp RT barcode](dT)VXXX...XXX         CTGTCTCTTATACACATCT -3'
                               3'- CGAGACNNNNNNNNNNATGCTGCGAGAAGGCTAGANNNNNNNNNNGTCTCG[8-bp UMI][10-bp RT barcode](pA)BXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                                  <---------GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(7) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNCAGAGCNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNCAGAGCNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
             Illumina P5              i5     This bit is Truseq adapter     9bp or 10bp     8bp UMI   10bp RT        cDNA             ME              s7           i7        Illumina P7
                                                                          hairpin barcode             barcode

Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the hairpin barcode + GTCTCG + UMI + RT barcodes, 34 cycles):


                                       5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT--------------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNCAGAGCNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index 1 sequencing primer to sequence i7 index (bottom strand as template, 10 cycles):


                                                                                                                         5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNCAGAGCNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the second index (i5 index) (bottom strand as template, 10 cycles):


5'- AATGATACGGCGACCACCGAGATCTACAC--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNCAGAGCNNNNNNNNNNNNNNNNNN(pA)BXXX...XXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, add Read 2 sequencing primer to sequence the second read (top strand as template, this is the cDNA read, 52 cycles):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNCAGAGCNNNNNNNNNNNNNNNNNN(dT)VXXX...XXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                                       <-----GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'