
The sci-RNA-seq uses the combinatorial indexing to identify single cells without single cell isolation. Two-level indexing (RT barcode + PCR barcodes (i5 + i7)) or three-level indexing (RT barcode + PCR barcodes (i5 + i7) + Tn5 barcodes) can be used. Three-level indexing is a bit more difficult since you need to assemble many indexed Tn5 transposomes. Here, two-level indexing strategy is demonstrated.

Adapter and primer sequences:


Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'




Index 1 sequencing primer (i7): 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Index 2 sequencing primer (i5): 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -3'


Step-by-step library generation

(1) Anneal Barcoded RT primer to mRNA in fixed cells and reverse transcription using MMLV in situ:

5'- ACGACGCTCTTCCGATCT[8-bp UMI][10-bp RT barcode](T)30VN---------->
                                                  (A)n BXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX -5'

(2) Pool all wells, and re-distribute into wells in a new plate, and perform RNaseH and DNA Pol I based second strand synthesis:


(3) Add 5ng genomic DNA as carrier, and use Illumina standard Nextera tagmentation on double stranded cDNA plus genomic DNA (will create 9-bp gap):

Tn5 dimer

Product 1 (s5 at both ends, not amplifiable due to the use of Illumina P5/P7 Primer, see the next step):


Product 2 (s7 at both ends, not amplifiable due to the use of Illumina P5/P7 Primer, see the next step):


Product 3 (different s5 and s7 at both ends, not amplifiable, due to the use of Illumina P5/P7 Primer, see the next step):


Product 4 (s5 at one end, 3' of cDNA at the other end, not amplifiable, due to the use of Illumina P5/P7 Primer, see the next step):


Product 5 (s7 at one end, 3' of cDNA at the other end, the only amplifiable product, see the next step):


(4) 72 degree gap fill-in (the first cycle in Nextera PCR):


(5) Adding Illumina P5/P7 Primers for library amplification:

                                                5'- ACGACGCTCTTCCGATCT[8-bp UMI][10-bp RT barcode](dT)VXXX...XXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'
                                                3'- TGCTGCGAGAAGGCTAGA[8-bp UMI][10-bp RT barcode](pA)BXXX...XXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                          <---------GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(6) Final library structure:

             Illumina P5              i5     This bit is Truseq adapter     8bp UMI   10bp RT        cDNA             ME              s7           i7        Illumina P7

Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the UMI and RT barcodes, 18 cycles):

                                       5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT----------------->

(2) Add Index 1 sequencing primer to sequence i7 index (bottom strand as template, 10 cycles):

                                                                                                         5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC--------->

(3) Cluster regeneration, add Index 2 sequencing primer to sequence the second index (i5 index) (top strand as template, 10 cycles):

                                  <--------TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA -5'

(4) Add Read 2 sequencing primer to sequence the second read (top strand as template, this is the cDNA read, 52 cycles):

                                                                                                       <-----GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'