
The sci-ATAC-seq uses the combinatorial indexing to identify single cells without single cell isolation. Cells can be identified by the unique combination of the Tn5 barcodes and i5/i7 indices (see below). In Cusanovich et al., 2015 and Cusanovich et al., 2018, they refer the exact method to an early study that was published in Nature Genetics (Amini et al., 2014). The sequences described here are taken from their Supplementary Table 4 from the Nature Genetics paper. Note the Tn5 sequences here are different from the Illumina Nextera Kit.

Adapter and primer sequences:



Tn5 binding site 19-bp Mosaic End (ME) bottom: 5'- /Phos/CTGTCTCTTATACACATCT -3'

P5 index primer entry point (s5): 5'- TCGTCGGCAGCGTCTCCACGC -3'

P7 index primer entry point (s7): 5'- GTCTCGTGGGCTCGGCTGTCCCTGTCC -3'




Index 1 sequencing primer (i7): 5'- CTGTCTCTTATACACATCTGAGGCGGAGACGGTG -3'

Index 2 sequencing primer (i5): 5'- CTGTCTCTTATACACATCTGCCGTCCTCGATCGC -3'


Step-by-step library generation

(1) Anneal Barcoded Tn5 sequences s5/s7 and Tn5 binding site 19-bp Mosaic End (ME) bottom strand to assemble Tn5 transposome:

Tn5 dimer

(2) Sort limited nulcei into wells, and perform tagmentation using barcoded Tn5 transposome:

Product 1 (s5 at both ends, not amplifiable due to semi-suppressive PCR:


Product 2 (s7 at both ends, not amplifiable due to semi-suppressiev PCR):


Product 3 (different ends, amplifiable):


(3) Pool all wells, and re-distribute into wells in a new plate, and perform library ampification using indexed P5/P7 primers:

                                                                                             TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCAC[8-bp Tn5 index]CCTGTCCCTGTCGGCTCGGGTGCTCTG -5'
                                                                                                                                                                                      <------CCTGTCCCTGTCGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Final library structure:

            Illumina P5             i5           s5             8 bp                          ME             gDNA               ME                         8 bp                s7              i7          Illumina P7
                                                            Tn5 barcode                                                                                Tn5 barcode

Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the gDNA reads):

                                                                  5'- GCGATCGAGGACGGCAGATGTGTATAAGAGACAG------------->

(2) Add Index 1 sequencing primer to sequence the Tn5 barcode and i7 index (bottom strand as template, 43 cycles, the first 8 bp are Tn5 barcodes, and the last 8 bp are i7 indices):

                                                                                                                   5'- CTGTCTCTTATACACATCTGAGGCGGAGACGGTG------------------------------------------>

(3) Cluster regeneration, add Index 2 sequencing primer to sequence the second index (i5 index) (top strand as template, 37 cycles??? not entirely sure! The first 8 bp are i5 indices, and the last 8 bp are Tn5 barcodes):

                                 <------------------------------------CGCTAGCTCCTGCCGTCTACACATATTCTCTGTC -5'

(4) Add Read 2 sequencing primer to sequence the second read (top strand as template, these are the gDNA reads):

                                                                                                         <-------------GACAGAGAATATGTGTAGACTCCGCCTCTGCCAC -5'