sci-ATAC-seq

The sci-ATAC-seq uses the combinatorial indexing to identify single cells without single cell isolation. Cells can be identified by the unique combination of the Tn5 barcodes and i5/i7 indices (see below). In Cusanovich et al., 2015 and Cusanovich et al., 2018, they refer the exact method to an early study that was published in Nature Genetics (Amini et al., 2014). The sequences described here are taken from their Supplementary Table 4 from the Nature Genetics paper. Note the Tn5 sequences here are different from the Illumina Nextera Kit.



Adapter and primer sequences:

Barcoded Tn5 sequence s5: 5'- TCGTCGGCAGCGTCTCCACGC[8-bp Tn5 index]GCGATCGAGGACGGCAGATGTGTATAAGAGACAG -3'

Barcoded Tn5 sequence s7: 5'- GTCTCGTGGGCTCGGCTGTCCCTGTCC[8-bp Tn5 index]CACCGTCTCCGCCTCAGATGTGTATAAGAGACAG -3'

Tn5 binding site 19-bp Mosaic End (ME) bottom: 5'- /Phos/AGATGTGTATAAGAGACAG -3'

P5 index primer entry point (s5): 5'- TCGTCGGCAGCGTCTCCACGC -3'

P7 index primer entry point (s7): 5'- GTCTCGTGGGCTCGGCTGTCCCTGTCC -3'

P5 index primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCTCCACGC -3'

P7 index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGCTGTCCCTGTCC -3'

Read 1 sequencing primer: 5'- GCGATCGAGGACGGCAGATGTGTATAAGAGACAG -3'

Index 1 sequencing primer (i7): 5'- CTGTCTCTTATACACATCTGAGGCGGAGACGGTG -3'

Read 2 seuquencing primer: 5'- CACCGTCTCCGCCTCAGATGTGTATAAGAGACAG -3'



Step-by-step library generation

(1) Anneal Barcoded Tn5 sequences s5/s7 and Tn5 binding site 19-bp Mosaic End (ME) bottom strand to assemble Tn5 transposome:

Tn5 dimer

(2) Sort limited nulcei into wells, and perform tagmentation using barcoded Tn5 transposome:


Product 1 (s5 at both ends, not amplifiable due to semi-suppressive PCR:

5'- TCGTCGGCAGCGTCTCCACGC[8-bp Tn5 index]GCGATCGAGGACGGCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                                                        TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACGGCAGGAGCTAGCG[8-bp Tn5 index]CGCACCTCTGCGACGGCTGCT -5'


Product 2 (s7 at both ends, not amplifiable due to semi-suppressiev PCR):

5'- GTCTCGTGGGCTCGGCTGTCCCTGTCC[8-bp Tn5 index]CACCGTCTCCGCCTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                                                              TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCAC[8-bp Tn5 index]CCTGTCCCTGTCGGCTCGGGTGCTCTG -5'


Product 3 (different ends, amplifiable):

5'- TCGTCGGCAGCGTCTCCACGC[8-bp Tn5 index]GCGATCGAGGACGGCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                                                        TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCAC[8-bp Tn5 index]CCTGTCCCTGTCGGCTCGGGTGCTCTG -5'

(3) Pool all wells, and re-distribute into wells in a new plate, and perform library ampification using indexed P5/P7 primers:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCTCCACGC------>
                                     5'- TCGTCGGCAGCGTCTCCACGC[8-bp Tn5 index]GCGATCGAGGACGGCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                                                                                             TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCAC[8-bp Tn5 index]CCTGTCCCTGTCGGCTCGGGTGCTCTG -5'
                                                                                                                                                                                      <------CCTGTCCCTGTCGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCTCCACGCNNNNNNNNGCGATCGAGGACGGCAGATGTGTATAAGAGACAGXXXXXX...XXXXXXCTGTCTCTTATACACATCTGAGGCGGAGACGGTGNNNNNNNNGGACAGGGACAGCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGAGGTGCGNNNNNNNNCGCTAGCTCCTGCCGTCTACACATATTCTCTGTCXXXXXX...XXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCACNNNNNNNNCCTGTCCCTGTCGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
            Illumina P5             i5           s5             8 bp                          ME             gDNA               ME                         8 bp                s7              i7          Illumina P7
                                                            Tn5 barcode                                                                                Tn5 barcode

Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the gDNA reads):


                                                                  5'- GCGATCGAGGACGGCAGATGTGTATAAGAGACAG------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGAGGTGCGNNNNNNNNCGCTAGCTCCTGCCGTCTACACATATTCTCTGTCXXXXXX...XXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCACNNNNNNNNCCTGTCCCTGTCGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index 1 sequencing primer to sequence the Tn5 barcode and i7 index (bottom strand as template, 43 cycles, the first 8 bp are Tn5 barcodes, and the last 8 bp are i7 indices):


                                                                                                                   5'- CTGTCTCTTATACACATCTGAGGCGGAGACGGTG------------------------------------------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGAGGTGCGNNNNNNNNCGCTAGCTCCTGCCGTCTACACATATTCTCTGTCXXXXXX...XXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCACNNNNNNNNCCTGTCCCTGTCGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the second index (i5 index) (bottom strand as template, 37 cycles??? not entirely sure! The first 8 bp are i5 indices, and the last 8 bp are Tn5 barcodes):


5'- AATGATACGGCGACCACCGAGATCTACAC------------------------------------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGAGGTGCGNNNNNNNNCGCTAGCTCCTGCCGTCTACACATATTCTCTGTCXXXXXX...XXXXXXGACAGAGAATATGTGTAGACTCCGCCTCTGCCACNNNNNNNNCCTGTCCCTGTCGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, add Read 2 sequencing primer to sequence the second read (top strand as template, these are the gDNA reads):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCTCCACGCNNNNNNNNGCGATCGAGGACGGCAGATGTGTATAAGAGACAGXXXXXX...XXXXXXCTGTCTCTTATACACATCTGAGGCGGAGACGGTGNNNNNNNNGGACAGGGACAGCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                         <-------------GACAGAGAATATGTGTAGACTCCGCCTCTGCCAC -5'