scTHS-seq

THS-seq, originally published by Sos et al., uses similar principles as ATAC-seq to investigate chromatin accessibility. The key difference is that in THS-seq, a Tn5 transoposome homodimer loaded with T7 promoter sequence is used for the tagmentation, and the resulting fragments are amplified by in vitro transcription. In this way, every Tn5 cutting event is theoretically amplifiable, whereas in the widely used Illumina Tn5 transposomes only 50% of fragments with distinct adapters can be amplified.

The scTHS-seq takes the combinatorial indexing strategy to make the original THS-seq method to work at the single cell level.



Adapter and primer sequences:

scT7_r5{001..384}_i5_top: 5'- AATTAATACGACTCACTATAGGGAGATCCACGCGC[6-bp Tn5 barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

* There are a total of 384 barcoded scT7_r5 sequences. For the full list, check Supplementary Table 12. from the publication.

nXTv2_i7_top: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

ME_bottom: 5'- /Phos/-CTGTCTCTTATACACATCT -3'

sss_scnXTv2: 5'- GGGAGATCCACGCGC -3'

T7 promoter: 5'- TAATACGACTCACTATAGGG -3'

Random hexamer for reverse transcription: 5'- [maybe there is an overhang]NNNNNN -3'

scT7_S5xx: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]GGGAGATCCACGCGC -3', these are similar to Nextera XT v2 S5xx primers.

* There are a total of 16 scT7_S5xx sequences. For the full list, check Supplementary Table 12. from the publication.

Nextera (XT) N7xx Index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

nXTv2_read1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

nXTv2_i7_index_read sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step generation of oligo-dT19V:

(1) Anneal the scT7_r5{001..384}_i5_top and ME_bottom sequences to assemble the Tn5 tranposome homodimer for the nulcei tagmentation in well plates. Sort ~960 nulcei per well and perform tagmentation:

Tn5 dimer

Since it is a Tn5 homodimer, there is only one product:

5'- AATTAATACGACTCACTATAGGGAGATCCACGCGC[6-bp Tn5 barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT -3'
                                                                   3'- TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT[6-bp Tn5 barcode]CGCGCACCTAGAGGGATATCACTCAGCATAATTAA -5'

(2) Stop tagmentation, pool all nuclei from all wells, redistribute ~100 nulcei per well to a new plate by FACS, destroy nulcei by adding guanidine hydrochloride, purify tagmented DNA by SPRI, and fill in the gaps by Taq enzyme:


5'- AATTAATACGACTCACTATAGGGAGATCCACGCGC[6-bp Tn5 barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTGACGCTGCCGACGA[6-bp Tn5 barcode]GCGCGTGGATCTCCCTATAGTGAGTCGTATTAATT -3'
3'- TTAATTATGCTGAGTGATATCCCTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT[6-bp Tn5 barcode]CGCGCACCTAGAGGGATATCACTCAGCATAATTAA -5'

(3) in vitro transcription to amplify the tagmented DNA which is from the open chromatin regions, and it seems when the IVT from the two symmetric strands clashes, one strand will dominate:


                  IVT starts from here
                          ↱
5'- AATTAATACGACTCACTATAGGGAGATCCACGCGC[6-bp Tn5 barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTGACGCTGCCGACGA[6-bp Tn5 barcode]GCGCGTGGATCTCCCTATAGTGAGTCGTATTAATT -3'
3'- TTAATTATGCTGAGTGATATCCCTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT[6-bp Tn5 barcode]CGCGCACCTAGAGGGATATCACTCAGCATAATTAA -5'
                                                                                                                                                                                    ↵
                                                                                                                                                                            IVT starts from here    

(4) Purify the amplified RNA (aRNA) using SPRI beads. This is the product of the IVT, which is the amplified RNA representing open chromatin regions:


5'- GAGAUCCACGCGC[6-bp Un5 barcode]UCGUCGGCAGCGUCAGAUGUGUAUAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCUGUCUCUUAUACACAUCUGACGCUGCCGACGA[6-bp Un5 barcode]GCGCGUGGAUCUCCCUAUAGUGAGUCGUAUUAAUU -3'

(5) Reverse transcription of the aRNA back to DNA using a random hexamer primer and MMLV reverse transcriptase:


5'- GAGAUCCACGCGC[6-bp Un5 barcode]UCGUCGGCAGCGUCAGAUGUGUAUAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCUGUCUCUUAUACACAUCUGACGCUGCCGACGA[6-bp Un5 barcode]GCGCGUGGAUCUCCCUAUAGUGAGUCGUAUUAAUU -3'
                                                                          <----------NNNNNN
                                                                                           [maybe there is an overhang] -5'

(6) This is the product after RT:


5'- GAGAUCCACGCGC[6-bp Un5 barcode]UCGUCGGCAGCGUCAGAUGUGUAUAAGAGACAGXXX...XXX[maybe there is an overhang] -3'
3'- CTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX[maybe there is an overhang] -5'

(7) RNaseH to degrade the RNA in the DNA-RNA hybrid above:


3'- CTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX[maybe there is an overhang] -5'

(8) Add the sss_scnXTv2 primer for the second strand synthesis:


5'- GGGAGATCCACGCGC-------------------->
  3'- CTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX[maybe there is an overhang] -5'

(9) Purify the product uisng SPRI beads:


5'- GGGAGATCCACGCGC[6-bp Tn5 barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXX[maybe there is an overhang] -3'
3'- CCCTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXX[maybe there is an overhang] -5'

(10) Anneal the nXTv2_i7_top and ME_bottom sequences to assemble another Tn5 tranposome homodimer for the tagmentation of the above double stranded DNA product:

Tn5 dimer

Product 1 (s7 at both ends, not amplifiable due to pimers used, see the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                   TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


Product 2 (not amplifiable due to pimers used, see the next step):

5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX[maybe there is an overhang] -3'
                   TCTACACATATTCTCTGTC         XXX...XXX[maybe there is an overhang] -5'


Product 3 (different adapters at the two ends, this will be amplified in the next step):

5'- GGGAGATCCACGCGC[6-bp Tn5 barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXX         CTGTCTCTTATACACATCT -3'
3'- CCCTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(11) Stop the reaction by adding guanidine hydrochloride, purify by SPRI beads, and use the scT7_S5xx and the Nextera (XT) N7xx Index primer to ampify the product:


5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]GGGAGATCCACGCGC--------->
                                            5'- GGGAGATCCACGCGC[6-bp Tn5 barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXX         CTGTCTCTTATACACATCT -3'
                                            3'- CCCTCTAGGTGCGCG[6-bp Tn5 barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                            <----------GGCTCGGGTGCTCTG[8-bp i7 index]TAGAGCATACGGCAGAAGACGAAC -5'

(12) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNGGGAGATCCACGCGCNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCCCTCTAGGTGCGCGNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5            i5 index                6 bp      s5               ME           gDNA           ME                s7      i7 index       Illumina P7
                                                     Tn5 barcode



Library sequencing:

(1) Add nXTv2_read1 sequencing primerto sequence the first read (bottom strand as template, these are the gDNA reads, 50 cycles):


                                                          5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCCCTCTAGGTGCGCGNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXX...XXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add nXTv2_i7_index_read sequencing primer to sequence the i7 index (bottom strand as template, 8 cycles):


                                                                                                          5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCCCTCTAGGTGCGCGNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXX...XXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Folds over and sequence the i5 and Tn5 barcodes (bottom strand as template, 32 cycles, single cells will be identified by the combination of i7, i5 and Tn5 barcodes):


5'- AATGATACGGCGACCACCGAGATCTACAC------------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNCCCTCTAGGTGCGCGNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXX...XXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'