scRRBS

The scRRBS method is originally published by Guo et al. in Genome Research. Later on, the authors published a detailed step-by-step protocol in Nature Protocols 10, 645-659. This web page is created according to their Nature Protocols publication.

scRRBS is based on reduced representation bisulfite sequencing (RRBS), where the genome is fragmented by a restriction enzyme (often MspI), and methyl-C is investigated in the resulting fragments. It is not whole genome, but it is cost effective and generates high coverage data especiallhy around CpG islands.



Adapter and primer sequences:

Universal Truseq adaptor (cytosines are methylated): 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Indexed Truseq adaptor (cytosines are mehtylated): 5'- /phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6-bp index]ATCTCGTATGCCGTCTTCTGCTTG -3'

Make Y-shaped Illumina adaptors by annealing the above two oligos:


                      5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC
                                                                       GCTCTTCCGATCT -3'
                                                                       CGAGAAGGCTAG -5'
          3'- GTTCGTCTTCTGCCGTATGCTCTA[6-bp index]CACTGACCTCAAGTCTGCACA

Illumina TruSeq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Illumina TruSeq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Sample index sequencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Illumina P5 (called QP1 in the paper): 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 (called QP2 in the paper): 5'- CAAGCAGAAGACGGCATACGAGAT -3'



Step-by-step library generation:

(1) Cell lysis and use MspI to fragment the genome:


                                                    Me
                                                    |
5'- XXXXXXXC  CGGXXXXXXXXXXXXCGXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXC  CGGXXXXXXX -3'
3'- XXXXXXXGGC  CXXXXXXXXXXXXGCXXXXXXXXX...XXXXXXXXXGCXXXXXXXXXXXXGGC  CXXXXXXX -5'
                                                     |
                                                     Me

(2) End repair and A tailing:


                                           Me
                                           |
5'-  CGGXXXXXXXXXXXXCGXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXCCGA -3'
3'- AGCCXXXXXXXXXXXXGCXXXXXXXXX...XXXXXXXXXGCXXXXXXXXXXXXGGC  -5'
                                            |
                                            Me

(3) Ligate the indexed Y-shaed Illumina adapters:


                                                                                                 Me
            5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC                                    |                          ACACGTCTGAACTCCAGTCAC[6-bp index]ATCTCGTATGCCGTCTTCTGCTTG -3'
                                                             GCTCTTCCGATCTCGGXXX...XXXCGXXX...XXXCGXXX...XXXCCGAGATCGGAAGAGC
                                                             CGAGAAGGCTAGAGCCXXX...XXXGCXXX...XXXGCXXX...XXXGGCTCTAGCCTTCTCG
3'- GTTCGTCTTCTGCCGTATGCTCTA[6-bp index]CACTGACCTCAAGTCTGCACA                                     |                         CAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA -5'
                                                                                                  Me

(4) Bisulfite converstion (cytosines in the adapters are methylated, so they won't be affected):


                                                                                                 Me
            5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC                                    |                          ACACGTCTGAACTCCAGTCAC[6-bp index]ATCTCGTATGCCGTCTTCTGCTTG -3'
                                                             GCTCTTCCGATCTUGGXXX...XXXUGXXX...XXXCGXXX...XXXUUGAGATCGGAAGAGC
                                                             CGAGAAGGCTAGAGUUXXX...XXXGUXXX...XXXGCXXX...XXXGGUTCTAGCCTTCTCG
3'- GTTCGTCTTCTGCCGTATGCTCTA[6-bp index]CACTGACCTCAAGTCTGCACA                                     |                         CAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA -5'
                                                                                                  Me

(5) PCR using Illumina P5 and P7 primers:



 (i) The First cycle (the product from the top and bottoms strands have the same structure, and the P5 primer has no place to anneal):

 Top strand:
                                                                                     Me
                                                                                     |
5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTUGGXXX...XXXUGXXX...XXXCGXXX...XXXUUGAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6-bp index]ATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                                                    <------------TAGAGCATACGGCAGAAGACGAAC -5'

 Bottom strand:

5'- CAAGCAGAAGACGGCATACGAGAT---------->
3'- GTTCGTCTTCTGCCGTATGCTCTA[6-bp index]CACTGACCTCAAGTCTGCACACGAGAAGGCTAGAGUUXXX...XXXGUXXX...XXXGCXXX...XXXGGUTCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA -5'
                                                                                                  |
                                                                                                  Me

 (ii) The second cycle and after (bottom strand ommitted):

5'- AATGATACGGCGACCACCGAGATCTACAC---------->
5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGXXX...XXXTGXXX...XXXCGXXX...XXXTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6-bp index]ATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAACCXXX...XXXACXXX...XXXGCXXX...XXXAACTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp index]TAGAGCATACGGCAGAAGACGAAC -5'
                                                                                                                                    <------------TAGAGCATACGGCAGAAGACGAAC -5'

(6) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGXXX...XXXTGXXX...XXXCGXXX...XXXTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAACCXXX...XXXACXXX...XXXGCXXX...XXXAACTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
             Illumina P5                 Truseq Read 1                        gDNA                           Truseq Read 2            6-bp        Illumina P7
                                                                                                                                   sample index



Library sequencing:

(1) Add Truseq read 1 sequencing primer to sequence the first read (bottom strand as template):


                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT--------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAACCXXX...XXXACXXX...XXXGCXXX...XXXAACTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index sequencing primer to sequence sample index (bottom strand as template, this is the cell barcode):


                                                                                               5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAACCXXX...XXXACXXX...XXXGCXXX...XXXAACTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add Truseq read 2 sequencing primer to sequence read 2 (top strand as template):


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGGXXX...XXXTGXXX...XXXCGXXX...XXXTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                          <--------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'