scBS-seq

scBS-seq is a technique to profile DNA methylation at the single cell level. It is based on the principle of bisulfite conversion. The trick here is to add sequencing adapters after the bisulfite conversion, because bisulfite treatment is damaing to DNA, which often causes DNA fragmentation. The adapter addition is achieved by random priming, whic is similar to MALBAC, wel ... kind of ... .

In the original publication in Nature Methods 11, 817–820. The authors used the iPCRtag primer for indexing. According to the Illumina Adapter sequence, the sequences used here is obsoltete. Check page 47 in the linked PDF. I still draw it here for historical reasons, but you can change that to modern Truseq structures, which can be easily found in other pages in this repository.



Adapter and primer sequences:

Oligo 1: 5'-/Bio/CTACACGACGCTCTTCCGATCTNNNNNNNNN -3'

Oligo 2: 5'- TGCTGAACCGCTCTTCCGATCTNNNNNNNNN -3'

PE1.0 forward primer: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

iPCRtag reverse primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp sample index]GAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

Read 1 sequencing primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Index sequencing primer: 5'- AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTC -3'

Read 2 sequencing primer: 5'- CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT -3'



Step-by-step library generation:

(1) Cell lysis :


                                              Me
                                              |
5'- XXXXXXXXXXXXXXXXXXXCGXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXXXXXXXX -3'
3'- XXXXXXXXXXXXXXXXXXXGCXXXXXXXXX...XXXXXXXXXGCXXXXXXXXXXXXXXXXXXX -5'
                                               |
                                               Me

(2) Bisulfite treatment (which will also fragment DNA):


                                              Me
                                              |
5'- XXXXXXXXXXXXXXXXXXXUGXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXXXXXXXX -3'
3'- XXXXXXXXXXXXXXXXXXXGUXXXXXXXXX...XXXXXXXXXGCXXXXXXXXXXXXXXXXXXX -5'
                                               |
                                               Me

(3) Denature, Oligo 1 annealing and Klenow extention. Klenow has strong strand displacement activity, so it will kick the primers at the front off the strand. Only one strand will be shown from now on:


5'-/Bio/CTACACGACGCTCTTCCGATCT
                              NNNNNNNNN----->
                       3'- XXXXXXXXXXXXXXXXXXXGUXXXXXXXXX...XXXXXXXXXGCXXXXXXXXXXXXXXXXXXX -5'
                                                                      |
                                                                      Me

(4) The above step is repeated five times, and products are denatured and purified by Straptavidin beads. Two types of products will be present at this stage:


 Product 1 (one adapter at 5' side):

  |--5'-/Bio/CTACACGACGCTCTTCCGATCTXXXXXXXXXCTXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXXXXXXXX -3'


 Product 2 (adapters at both 5' and 3' ends):

  |--5'-/Bio/CTACACGACGCTCTTCCGATCTXXXXXXXXXCTXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGCGTCGTGTAG -3'


(5) Random priming with Oligo 2 using similar strategy above:


|--5'-/Bio/CTACACGACGCTCTTCCGATCTXXXXXXXXXCTXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXXXXXXXX -3'
                                                                    <-----NNNNNNNNN
                                                                                    TCTAGCCTTCTCGCCAAGTCGT -5'


|--5'-/Bio/CTACACGACGCTCTTCCGATCTXXXXXXXXXCTXXXXXXXXX...XXXXXXXXXCGXXXXXXXXXXXXXXXXXXXAGATCGGAAGAGCGTCGTGTAG -3'
                                                                    <-----NNNNNNNNN
                                                                                   TCTAGCCTTCTCGCCAAGTCGT -5'

(6) Purify products:


|--5'-/Bio/CTACACGACGCTCTTCCGATCTXXX...XXXCTXXX...XXXCGXXX...XXXAGATCGGAAGAGCGGTTCAGCA -3'
   3'-     GATGTGCTGCGAGAAGGCTAGAXXX...XXXGAXXX...XXXGCXXX...XXXTCTAGCCTTCTCGCCAAGTCGT -5'

(7) Adding PE1.0 forward primer and iPCRtag reverse primer for library amplification:


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT------>
                             |--5'-/Bio/CTACACGACGCTCTTCCGATCTXXX...XXXCTXXX...XXXCGXXX...XXXAGATCGGAAGAGCGGTTCAGCA -3'
                                    3'- GATGTGCTGCGAGAAGGCTAGAXXX...XXXGAXXX...XXXGCXXX...XXXTCTAGCCTTCTCGCCAAGTCGT -5'
                                                                                      <------TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTCTGGCTAGAG[8-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX...XXXCTXXX...XXXCGXXX...XXXAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX...XXXGAXXX...XXXGCXXX...XXXTCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTCTGGCTAGAGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
             Illumina P5                 PE Read 1                        gDNA                               PE Read 2                   8-bp          Illumina P7
                                                                                                                                     sample index



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template):


                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX...XXXGAXXX...XXXGCXXX...XXXTCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTCTGGCTAGAGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index sequencing primer to sequence sample index (bottom strand as template, this is the cell barcode):


                                                                                         5'- AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX...XXXGAXXX...XXXGCXXX...XXXTCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTCTGGCTAGAGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add Read 2 sequencing primer to sequence read 2 (top strand as template):


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX...XXXCTXXX...XXXCGXXX...XXXAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                    <--------TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTCTGGC -5'