inDrop

inDrop was originally pulished in Cell 161, 1187–1201 (2015). Then, two years after that, the authors published the detailed protocol in Nature Protocols 12, 44–73 (2017), which has different primer design comparing to the orginal paper. The workflow shown here is based on the Nature Protocol paper, which seems to be the version 2 of the inDrop technology. According to the inDrop github page, there is a version 3, but the oligos and library structures are exactly the same as version 2, except the sequencing mode has changed. In version 2, three different reads are generated; in version 3, four different reads are generated. See details below.



Adapter and primer sequences:

Sequence used during the experiment:

*Beads-oligo-dT19V: |--5'- /5Acryd/iSpPC/CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTCCGATCT[barcode1]GAGTGATTGCTTGTGACGCCTT[8-bp barcode2][6-bp UMI]TTTTTTTTTTTTTTTTTTV -3'

T7 promoter: 5'- TAATACGACTCACTATAGGG -3'

PE1 adapter: 5'- CTCTTTCCCTACACGACGCTCTTC -3'

PE2 adapter: 5'- TCGGCATTCCTGCTGAACCGCTCTTCCGATCT -3'

PE2-N6 RT primer: 5'- TCGGCATTCCTGCTGAACCGCTCTTCCGATCTNNNNNN -3'

W1 sequence: 5'- AAGGCGTCACAAGCAATCACTC -3'

PE1 PCR primer: 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]CTCTTTCCCTACACGA -3'

PE2 PCR primer: 5'- AATGATACGGCGACCACCGAGATCTACACGGTCTCGGCATTCCTGCTGAAC -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Read 1 sequencing primer: 5'- GGCATTCCTGCTGAACCGCTCTTCCGATCT -3'

Index sequencing primer: 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAG -3'

Read 2 sequencing primer: 5'- CTCTTTCCCTACACGACGCTCTTCCGATCT -3'

* barcode1 has variable length.

Sequence used for barcoded oligo-dT19V generation (before the experiment):

Acrydite-modified primer: 5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTC -3'

BA19 oligo: 5'- BAAAAAAAAAAAAAAAAAAA -3'

FAM-PE1 probe: 5'-/6-FAM/ AGATCGGAAGAGCGTCGTGTAGGGAAAGAG -3'

FAM-W1 probe: 5'-/6-FAM/ AAGGCGTCACAAGCAATCACTC -3'

FAM-BA19 probe: 5'-/6-FAM/ BAAAAAAAAAAAAAAAAAAA -3'

Barcode 1 plates (384 of them in 384 individual wells): 5'- AAGGCGTCACAAGCAATCACTC[barcode1]AGATCGGAAGAGCGTCGTGTAGGGAAAGAG -3', for the sequences of 384 different barcode1, see inDrop_barcode1_list.txt.

Barcode 2 plates (384 of them in 384 individual wells): 5'- BAAAAAAAAAAAAAAAAAAA[6-bp UMI][8-bp barcode2]AAGGCGTCACAAGCAATCACTC -3', for the sequences of 384 different barcode2 (8 bp), see inDrop_barcode2_list.txt.



Step-by-step generation of oligo-dT19V:

(1) Bind Acrydite-modified primer to acrylimide gel beads by mixing:


|--5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTC -3'

(2) Split the gel beads with bound primers into wells in Barcode 1 plates, and primer extension:


                                                      <--------GAGAAAGGGATGTGCTGCGAGAAGGCTAGA[barcode1]CTCACTAACGAACACTGCGGAA -5'
|--5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTC-------->

(3) This is the product after the first extension:


                   3'- GCTACTGCATTATGCTGAGTGATATCCCTATGGTGGTACCGAGAAAGGGATGTGCTGCGAGAAGGCTAGA[barcode1]CTCACTAACGAACACTGCGGAA -5'
|--5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTCCGATCT[barcode1]GAGTGATTGCTTGTGACGCCTT

(4) Pooling, denature by NaOH, and get rid of top strand:


|--5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTCCGATCT[barcode1]GAGTGATTGCTTGTGACGCCTT

(5) Split again into wells in Barcode 2 plates, and primer extension:


                                                                                              <--------CTCACTAACGAACACTGCGGAA[8-bp barcode2][6-bp UMI]A19B -5'
|--5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTCCGATCT[barcode1]GAGTGATTGCTTGTGACGCCTT---------->

(6) This is the product of second extension:


                   3'- GCTACTGCATTATGCTGAGTGATATCCCTATGGTGGTACCGAGAAAGGGATGTGCTGCGAGAAGGCTAGA[barcode1]CTCACTAACGAACACTGCGGAA[8-bp barcode2][6-bp UMI]A19B -5'
|--5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTCCGATCT[barcode1]GAGTGATTGCTTGTGACGCCTT[8-bp barcode2][6-bp UMI]T19V -3'

(7) Pool aggain, denautre by NaOH, get rid of top strand, neutralise, wash and ready to use (384 x 384 different combination of barcodes 1 & 2):


|--5'-/acrydite/iSpPC/ CGATGACGTAATACGACTCACTATAGGGATACCACCATGGCTCTTTCCCTACACGACGCTCTTCCGATCT[barcode1]GAGTGATTGCTTGTGACGCCTT[8-bp barcode2][6-bp UMI]T19V -3'



Step-by-step library generation (the 5'-/acrydite/iSpPC/ is omitted for simplicity)

(1) Anneal oligo-dT19V to mRNA and reverse transcription using MMLV inside droplets:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <-----V(T)19[6-bp UMI][8-bp barcode2]TTCCGCAGTGTTCGTTAGTGAG[barcode1]TCTAGCCTTCTCGCAGCACATCCCTTTCTCGGTACCACCATAGGGATATCACTCAGCATAATGCAGTAGC -5'--|

(2) RNaseH and DNA Pol I based second strand synthesis:


5'- XXX...XXXB(pA)[6-bp UMI][8-bp barcode2]AAGGCGTCACAAGCAATCACTC[barcode1]AGATCGGAAGAGCGTCGTGTAGGGAAAGAGCCATGGTGGTATCCCTATAGTGAGTCGTATTACGTCATCG
    XXX...XXXV(dT)[6-bp UMI][8-bp barcode2]TTCCGCAGTGTTCGTTAGTGAG[barcode1]TCTAGCCTTCTCGCAGCACATCCCTTTCTCGGTACCACCATAGGGATATCACTCAGCATAATGCAGTAGC -5'--|
                                                                                                                    ↵
                                                                                                             IVT starts from here

(3) Break droplets and T7 in vitro transcription to amplify cDNA (resulting in single stranded RNA):


5'- GAUACCACCAUGGCUCUUUCCCUACACGACGCUCUUCCGAUCU[barcode1]GAGUGAUUGCUUGUGACGCCUU[8-bp barcode2][6-bp UMI](dU)VXXX...XXX -3'

(4) Reverse transcription on amplified RNA (aRNA) using random priming (PE2-N6)


5'- GAUACCACCAUGGCUCUUUCCCUACACGACGCUCUUCCGAUCU[barcode1]GAGUGAUUGCUUGUGACGCCUU[8-bp barcode2][6-bp UMI](dU)VXXX...XXX -3'
                                                                                                      <-------NNNNNN
                                                                                                                    TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCT -5'

(5) Fist strand cDNA of aRNA looks like this:


5'- TCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXX...XXXV(pA)[6-bp UMI][8-bp barcode2]AAGGCGTCACAAGCAATCACTC[barcode1]AGATCGGAAGAGCGTCGTGTAGGGAAAGAGCCATGGTGGTATC -3'

(6) Adding PE1 PCR and PE2 PCR primers to amplify the first strand cDNA:


5'- AATGATACGGCGACCACCGAGATCTACACGGTCTCGGCATTCCTGCTGAAC---------->
                                 5'- TCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXX...XXXV(pA)[6-bp UMI][8-bp barcode2]AAGGCGTCACAAGCAATCACTC[barcode1]AGATCGGAAGAGCGTCGTGTAGGGAAAGAGCCATGGTGGTATC -3'
                                                                                                                                               <----------AGCACATCCCTTTCTC
                                                                                                                                                                          [6-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'

(9) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXX...XXXV(pA)NNNNNNNNNNNNNNAAGGCGTCACAAGCAATCACTCNN....NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGNNNNNNATCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATGTGCCAGAGCCGTAAGGACGACTTGGCGAGAAGGCTAGAXXX...XXXV(dT)NNNNNNNNNNNNNNTTCCGCAGTGTTCGTTAGTGAGNN....NNTCTAGCCTTCTCGCAGCACATCCCTTTCTCNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
            Illumina P5                           PE2                   cDNA        6bp    8bp            W1           barcode1               PE1             6bp         Illumina P7
                                                                                    UMI  barcode2                                                          sample index



V2 Library sequencing (three steps):

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the cDNA reads):


                                   5'- GGCATTCCTGCTGAACCGCTCTTCCGATCT--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCCAGAGCCGTAAGGACGACTTGGCGAGAAGGCTAGAXXX...XXXV(pA)NNNNNNNNNNNNNNTTCCGCAGTGTTCGTTAGTGAGNN....NNTCTAGCCTTCTCGCAGCACATCCCTTTCTCNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index sequencing primer to sequence sample index (bottom strand as template):


                                                                                                                           5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAG----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCCAGAGCCGTAAGGACGACTTGGCGAGAAGGCTAGAXXX...XXXV(pA)NNNNNNNNNNNNNNTTCCGCAGTGTTCGTTAGTGAGNN....NNTCTAGCCTTCTCGCAGCACATCCCTTTCTCNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add read 2 sequencing primer to sequence read 2 (top strand as template, these are the cell barcodes and UMI reads, at least 51 cycles):


5'- AATGATACGGCGACCACCGAGATCTACACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXX...XXXV(pA)NNNNNNNNNNNNNNAAGGCGTCACAAGCAATCACTCNN....NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                   <-------------------------------------------TCTAGCCTTCTCGCAGCACATCCCTTTCTC -5'



V3 Library sequencing (four steps), this is just a guess based on the github page description and sample fastq files, not confirmed:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, these are the cDNA reads):


                                   5'- GGCATTCCTGCTGAACCGCTCTTCCGATCT--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCCAGAGCCGTAAGGACGACTTGGCGAGAAGGCTAGAXXX...XXXV(pA)NNNNNNNNNNNNNNTTCCGCAGTGTTCGTTAGTGAGNN....NNTCTAGCCTTCTCGCAGCACATCCCTTTCTCNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add reverse complement of W1 primer primer to sequence barcode1 (bottom strand as template, 6 cycles):


                                                                                             5'- AAGGCGTCACAAGCAATCACTC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCCAGAGCCGTAAGGACGACTTGGCGAGAAGGCTAGAXXX...XXXV(pA)NNNNNNNNNNNNNNTTCCGCAGTGTTCGTTAGTGAGNN....NNTCTAGCCTTCTCGCAGCACATCCCTTTCTCNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Add Index sequencing primer to sequence sample index (bottom strand as template, 6 cycles)::


                                                                                                                           5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAG----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCCAGAGCCGTAAGGACGACTTGGCGAGAAGGCTAGAXXX...XXXV(pA)NNNNNNNNNNNNNNTTCCGCAGTGTTCGTTAGTGAGNN....NNTCTAGCCTTCTCGCAGCACATCCCTTTCTCNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(4) Cluster regeneration, and add W1 primer to sequence barcode2 and UMI (top strand as template, seems to be 21 cycles, contain a bit of dT at the end):


5'- AATGATACGGCGACCACCGAGATCTACACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXX...XXXV(pA)NNNNNNNNNNNNNNAAGGCGTCACAAGCAATCACTCNN....NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                            <--------------------TTCCGCAGTGTTCGTTAGTGAG -5'