Illumina Bio-Rad SureCell 3' WTA for ddSEQ



Adapter and primer sequences:

*Beads-read1-oligo-dTV: |--5'- AAGCAGTGGTATCAACGCAGAGTAC[6-bp barcode1]TAGCCATCGCATTGC[6-bp barcode2]TACCTCTGAGCTGAA[6-bp barcode3]ACG[8-bp UMI]GAC(dT)V -3'

Spacer 1: 5'- TAGCCATCGCATTGC -3'

Spacer 2: 5'- TACCTCTGAGCTGAA -3'

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

DNA Adapters (N7xx): 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp sample index]GTCTCGTGGGCTCGG -3'

Tagment PCR Adapter (TPP1): 5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Read 1 sequencing primer: 5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC -3'

Index sequencing primer: 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

* The cell barcode in this protocol is based on the combination of the barcode1+barcode2+barcode3. 6-bp each, and 18-bp in total. The full oligos are generated in a split-pool manner. The 6-bp barcode can be found at the umis GitHub page.



Step-by-step library generation:

(1) Anneal oligo-dTV to mRNA and reverse transcription inside droplets:


|--5'- AAGCAGTGGTATCAACGCAGAGTAC[6-bp barcode1]TAGCCATCGCATTGC[6-bp barcode2]TACCTCTGAGCTGAA[6-bp barcode3]ACG[8-bp UMI]GAC(dT)V --->
                                                                                                                           (pA)BXXXXXXXXXXXXXXXX -5'

(2) Break emulsion, clean up and RNaseH and DNA Pol I based second strand synthesis:


5'- AAGCAGTGGTATCAACGCAGAGTAC[6-bp barcode1]TAGCCATCGCATTGC[6-bp barcode2]TACCTCTGAGCTGAA[6-bp barcode3]ACG[8-bp UMI]GAC(dT)VXXX...XXX -3'
3'- TTCGTCACCATAGTTGCGTCTCATG[6-bp barcode1]ATCGGTAGCGTAACG[6-bp barcode2]ATGGAGACTCGACTT[6-bp barcode3]TGC[8-bp UMI]CTG(pA)BXXX...XXX -5'

(3) Clean double stranded cDNA, and tagmentation using Nextera SureCell transposome (highly likely a Tn5 homodimer with s7-ME oligo):

Tn5 dimer

5'- AAGCAGTGGTATCAACGCAGAGTAC[6-bp barcode1]TAGCCATCGCATTGC[6-bp barcode2]TACCTCTGAGCTGAA[6-bp barcode3]ACG[8-bp UMI]GAC(dT)VXXX...XXX         CTGTCTCTTATACACATCT
3'- TTCGTCACCATAGTTGCGTCTCATG[6-bp barcode1]ATCGGTAGCGTAACG[6-bp barcode2]ATGGAGACTCGACTT[6-bp barcode3]TGC[8-bp UMI]CTG(pA)BXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(4) Add DNA Adapter (N7xx) and TPP1 to amplify tagmented cDNA for library preparation:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-------->
                                         5'- AAGCAGTGGTATCAACGCAGAGTAC[6-bp barcode1]TAGCCATCGCATTGC[6-bp barcode2]TACCTCTGAGCTGAA[6-bp barcode3]ACG[8-bp UMI]GAC(dT)VXXX...XXX         CTGTCTCTTATACACATCT
                                         3'- TTCGTCACCATAGTTGCGTCTCATG[6-bp barcode1]ATCGGTAGCGTAACG[6-bp barcode2]ATGGAGACTCGACTT[6-bp barcode3]TGC[8-bp UMI]CTG(pA)BXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                                                                                                                  <--------GGCTCGGGTGCTCTG[8bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'

(5) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNTAGCCATCGCATTGCNNNNNNTACCTCTGAGCTGAANNNNNNACGNNNNNNNNGAC(dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNATCGGTAGCGTAACGNNNNNNATGGAGACTCGACTTNNNNNNTGCNNNNNNNNCTG(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
            Illumina P5                                              barcode1             barcode2             barcode3     8bp            cDNA           ME               s7          8bp          Illumina P7
                                                                                                                            UMI                                                    sample index



Library sequencing:

(1) Add Read 1 sequencing primer to sequence the first read (68 cycles, bottom strand as template, sequence barcode1+barcode2+barcode3, UMI and a bit dT):


                             5'- GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNATCGGTAGCGTAACGNNNNNNATGGAGACTCGACTTNNNNNNTGCNNNNNNNNCTG(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index sequencing primer to sequence sample index (bottom strand as template):


                                                                                                                                              5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGCGGACAGGCGCCTTCGTCACCATAGTTGCGTCTCATGNNNNNNATCGGTAGCGTAACGNNNNNNATGGAGACTCGACTTNNNNNNTGCNNNNNNNNCTG(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add read 2 sequencing primer to sequence read 2 (75 cycles, top strand as template, these are cDNA reads):


5'- AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACNNNNNNTAGCCATCGCATTGCNNNNNNTACCTCTGAGCTGAANNNNNNACGNNNNNNNNGAC(dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                                              <-------------------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'