STRT-seq / STRT-seq-C1 / STRT-seq-2i



STRT-seq

STRT-seq was originally pulished in Genome Res. 21: 1160-1167 (2011). One year after that, the authors published the detailed protocol in Nature Protocols 7, 813–828 (2012), which is only slightly different from the orginal paper. The workflow shown here is based on the protocol in Nature Protocols 7, 813–828 (2012).

Adapter and primer sequences:

oligo-dTVN: 5'-Bio- TTAAGCAGTGGTATCAACGCAGAGTCGACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'

Barcoded Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTGCAGTGCT[6-bp cell barcode]rGrGrG -3'

ISPCR: 5′-Bio- AAGCAGTGGTATCAACGCAGAGT -3′

*Solexa P1 adapter: 5'- AATGATACGGCGACCACCGA -3'

*Solexa P2 adapter: 5'- CAAGCAGAAGACGGCATACGA -3'

Library PCR primer 1: 5'- AATGATACGGCGACCACCGAGATCTAAGCAGTGGTATCAACGCAGAGT -3'

Library PCR primer 2: 5'- CAAGCAGAAGACGGCATACGAG -3'

Doube stranded P2 adapter with T overhang:

5'- CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T -3'
     3'- GTTCGTCTTCTGCCGTATGCTCGAGAAGGCTAG  -5'

* Recent sequencing libraries use Illumina P5/P7 adapters, instead of Solexa P1/P2 adapters.



Step-by-step library generation

(1) Anneal oligo-dTVN to mRNA and reverse transcription using MMLV:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <----NV(T)30CAGCTGAGACGCAACTATGGTGACGAATT -Bio-5'

(2) After reverse transcription, the terminal tranferase acitivity of MMLV add extra Cs:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
 CCCXXXXXXXXXXXXXXXXXXNV(T)30CAGCTGAGACGCAACTATGGTGACGAATT -Bio-5'

(3) Adding Barcoded TSO for second strand synthesis:


5'- AAGCAGTGGTATCAACGCAGAGTGCAGTGCT[6-bp cell barcode]GGGXXXXXXXXXXXXXXXXXXXX(A)n
                                                      CCCXXXXXXXXXXXXXXXXXXXX(T)30CAGCTGAGACGCAACTATGGTGACGAATT -Bio-5'

(4) Adding ISPCR for single primer cDNA amplification:( i.e. semi-suppressive PCR )


5'-Bio- AAGCAGTGGTATCAACGCAGAGT---->
5'-     AAGCAGTGGTATCAACGCAGAGTGCAGTGCT[6-bp cell barcode]GGGXXXXXXX...XXXXXXX(pA)GTCGACTCTGCGTTGATACCACTGCTTAA
        TTCGTCACCATAGTTGCGTCTCACGTCACGA[6-bp cell barcode]CCCXXXXXXX...XXXXXXX(dT)CAGCTGAGACGCAACTATGGTGACGAATT -Bio-5'
                                                                                 <----TGAGACGCAACTATGGTGACGAA -Bio-5'

(5) Streptavidin beads binding, and cDNA fragmentation using DNase I in the presence of Mn2+, which preferentially causes double-stranded breaks:


Product 1 (5'-end of cDNA):

|--5'-Bio- AAGCAGTGGTATCAACGCAGAGTGCAGTGCT[6-bp cell barcode]GGGXXXXXXX...XXXXXXX
           TTCGTCACCATAGTTGCGTCTCACGTCACGA[6-bp cell barcode]CCCXXXXXXX...XXXXXXX -5'



Product 2 (3'-end of cDNA): |--5'-Bio- AAGCAGTGGTATCAACGCAGAGTCGAC(dT)XXXXXXXXXX...XXXXXXXXXX TTCGTCACCATAGTTGCGTCTCAGCTG(pA)XXXXXXXXXX...XXXXXXXXXX -5'


(6) A tailing:


Prodcut 1 (5'-end of cDNA):

|--5'-Bio- AAGCAGTGGTATCAACGCAGAGTGCAGTGCT[6-bp cell barcode]GGGXXXXXXX...XXXXXXX*A
           TTCGTCACCATAGTTGCGTCTCACGTCACGA[6-bp cell barcode]CCCXXXXXXX...XXXXXXX   -5'



Product 2 (3'-end of cDNA): |--5'-Bio- AAGCAGTGGTATCAACGCAGAGTCGAC(dT)XXXXXXXXXX...XXXXXXXXXX*A TTCGTCACCATAGTTGCGTCTCAGCTG(pA)XXXXXXXXXX...XXXXXXXXXX -5'


(7) Ligation with doube stranded P2 adapter with T overhang, and at the same time, SalI digestion (5'...GTCGAC...3'):


Product 1 (5'-end of cDNA, will not be affected by SalI):

|--5'-Bio- AAGCAGTGGTATCAACGCAGAGTGCAGTGCT[6-bp cell barcode]GGGXXXXXXX...XXXXXXX*AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
           TTCGTCACCATAGTTGCGTCTCACGTCACGA[6-bp cell barcode]CCCXXXXXXX...XXXXXXX TCTAGCCTTCTCGAGCATACGGCAGAAGACGAAC -5'



Product 2 (3'-end of cDNA, will be cut by SalI, this product is omitted later since it cannot be amplified:): |--5'-Bio- AAGCAGTGGTATCAACGCAGAG TCGAC(dT)XXXXXXXXXX...XXXXXXXXXX*AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG TTCGTCACCATAGTTGCGTCTCAGCT G(pA)XXXXXXXXXX...XXXXXXXXXX TCTAGCCTTCTCGAGCATACGGCAGAAGACGAAC -5'


(8) Add Library PCR Primers 1&2 for amplification:


5'- AATGATACGGCGACCACCGAGATCTAAGCAGTGGTATCAACGCAGAGT----->
                  |--5'-Bio- AAGCAGTGGTATCAACGCAGAGTGCAGTGCT[6-bp cell barcode]GGGXXXXXXX...XXXXXXXAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
                             TTCGTCACCATAGTTGCGTCTCACGTCACGA[6-bp cell barcode]CCCXXXXXXX...XXXXXXXTCTAGCCTTCTCGAGCATACGGCAGAAGACGAAC -5'
                                                                                                        <------GAGCATACGGCAGAAGACGAAC -5'

(9) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTAAGCAGTGGTATCAACGCAGAGTGCAGTGCTNNNNNNGGGXXXXXXX...XXXXXXXAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATTCGTCACCATAGTTGCGTCTCACGTCACGANNNNNNCCCXXXXXXX...XXXXXXXTCTAGCCTTCTCGAGCATACGGCAGAAGACGAAC -5'
          Solexa P1                ISPCR/TSO                  6bp                                       Solexa P2
                                                             cell
                                                            barcode



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, the first 6-bp of the read will be the cell barcode):


                    5'- GATCTAAGCAGTGGTATCAACGCAGAGTGCAGTGCT--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATTCGTCACCATAGTTGCGTCTCACGTCACGANNNNNNCCCXXXXXXX...XXXXXXXTCTAGCCTTCTCGAGCATACGGCAGAAGACGAAC -5'

(2) Cluster regeneration, add read 2 sequencing primer to sequence the second read (top strand as template, not sure whether this step is actually perfromed):


5'- AATGATACGGCGACCACCGAGATCTAAGCAGTGGTATCAACGCAGAGTGCAGTGCTNNNNNNGGGXXXXXXX...XXXXXXXAGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
                                                                              <-------TCTAGCCTTCTCGAGCATACGGCAGAAGACGAAC -5'





STRT-seq-C1

Adapter and primer sequences:

C1-P1-T31: 5'-Bio- AATGATACGGCGACCACCGATCGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3'

C1-P1-RNA-TSO: 5'-Bio- AAUGAUACGGCGACCACCGAU[5-bp UMI]GGG -3'

C1-P1-PCR-2 primer: 5'-Bio- GAATGATACGGCGACCACCGAT -3'

Barcoded C1-Tn5 top (including 19-bp Mosaic End (ME)): 5'- CAAGCAGAAGACGGCATACGA[8-bp cell barcode]GCGTCAGATGTGTATAAGAGACAG -3'

Universal C1-Tn5 bottom: 5'- CTGTCTCTTATACACATCTGACGC -3'

Annealed Tn5 oligos for Tn5 transposome assembly:

5'- CAAGCAGAAGACGGCATACGA[8-bp cell barcode]GCGTCAGATGTGTATAAGAGACAG -3'
                                                  3'- TCTACACATATTCTCTGTC -5'

*Solexa P1 adapter: 5'- AATGATACGGCGACCACCGA -3'

*Solexa P2 adapter: 5'- CAAGCAGAAGACGGCATACGA -3'

* Recent sequencing libraries use Illumina P5/P7 adapters, instead of Solexa P1/P2 adapters.



Step-by-step library generation

(1) Anneal C1-P1-T31 to mRNA and reverse transcription using MMLV:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <----NV(T)31GCTAGCCACCAGCGGCATAGTAA -Bio-5'

(2) After reverse transcription, the terminal tranferase acitivity of MMLV add extra Cs:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
 CCCXXXXXXXXXXXXXXXXXXNV(T)31GCTAGCCACCAGCGGCATAGTAA -Bio-5'

(3) Adding C1-P1-RNA-TSO for second strand synthesis:


5'-Bio- AAUGAUACGGCGACCACCGAU[5-bp UMI]GGGXXXXXXXXXXXXXXXXXXXX(A)n
                                       CCCXXXXXXXXXXXXXXXXXXXX(T)31GCTAGCCACCAGCGGCATAGTAA -Bio-5'

(4) cDNA amplification using single C1-P1-PCR-2 primer:( i.e. semi-suppressive PCR )


5'-Bio- GAATGATACGGCGACCACCGAT---->
5'-Bio-  AAUGAUACGGCGACCACCGAU[5-bp UMI]GGGXXXXXXXXXXXXXXXXXXXX(pA)CGATCGGTGGTCGCCGTATCATT
         TTACTATGCCGCTGGTGGCTA[5-bp UMI]CCCXXXXXXXXXXXXXXXXXXXX(dT)GCTAGCCACCAGCGGCATAGTAA -Bio-5'
                                                                <----TAGCCACCAGCGGCATAGTAAG -Bio-5'

(5) Homemade Tn5 homodimers using C1-Tn5_top/bottom tagmentation on amplified cDNA (will create 9-bp gap):

Tn5 strt homodimer

Product 1 (5'-end of cDNA):

5'-Bio- GAATGATACGGCGACCACCGAT[5-bp UMI]GGGXXXXXXX...XXX         CTGTCTCTTATACACATCT
        CTTACTATGCCGCTGGTGGCTA[5-bp UMI]CCCXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp cell barcode]AGCATACGGCAGAAGACGAAC -5'

Product 2 (3'-end of cDNA):

5'-Bio- GAATGATACGGCGACCACCGATCG(dT)XXXXXXX...XXX         CTGTCTCTTATACACATCT
        CTTACTATGCCGCTGGTGGCTAGC(pA)XXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp cell barcode]AGCATACGGCAGAAGACGAAC -5'

(6) Streptavidin beads binding. and PvuI cleavage (5'...CGATCG...3')


Product 1 (5'-end of cDNA) will not be affected:

|--5'-Bio- GAATGATACGGCGACCACCGAT[5-bp UMI]GGGXXXXXXX...XXX         CTGTCTCTTATACACATCT
           CTTACTATGCCGCTGGTGGCTA[5-bp UMI]CCCXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp cell barcode]AGCATACGGCAGAAGACGAAC -5'

Product 2 (3'-end of cDNA) will be cut by PvuI (this product is omitted later since it cannot be amplified):

|--5'-Bio- GAATGATACGGCGACCACCGAT   CG(dT)XXXXXXX...XXX         CTGTCTCTTATACACATCT
           CTTACTATGCCGCTGGTGGC   TAGC(pA)XXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp cell barcode]AGCATACGGCAGAAGACGAAC -5'

(7) NaOH denature Product 1 (5'-end of cDNA), and library amplification with P1 and P2 adapters using bottom strand as template:


5'-  AATGATACGGCGACCACCGAT-------->
3'- CTTACTATGCCGCTGGTGGCTA[5-bp UMI]CCCXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp cell barcode]AGCATACGGCAGAAGACGAAC -5'
                                                                                              <---------AGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:


5'- AATGATACGGCGACCACCGATNNNNNGGGXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTGACGCNNNNNNNNTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTANNNNNCCCXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGNNNNNNNNAGCATACGGCAGAAGACGAAC -5'
        Solexa P1          UMI          cDNA                   ME                 8bp        Solexa P2
                                                                                  cell
                                                                                 barcode



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template, the first 5-bp of the read will be UMI):


5'- TTACTATGCCGCTGGTGGCTA-------->
3'- TTACTATGCCGCTGGTGGCTANNNNNCCCXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGNNNNNNNNAGCATACGGCAGAAGACGAAC -5'

(2) Add index sequencing primer to sequence cell barcodes (bottom strand as template):


                                                   5'- CTGTCTCTTATACACATCTGACGC------->
3'- TTACTATGCCGCTGGTGGCTANNNNNCCCXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGNNNNNNNNAGCATACGGCAGAAGACGAAC -5'





STRT-seq-2i

This method is similar to STRT-seq-C1, but with nanowell capture and different oigo design, and there probably a mistake in the sequence of DI-Read1-Seq at this time of the preprint (29-08-2017), where there should be only five Ns in DI-Read1-Seq. There are currently six Ns in it.



Adapter and primer sequences:

C1-P1-T31: 5'-Bio- AATGATACGGCGACCACCGATCGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -3'

P1B-UMI-RNA-TSO: 5'-Bio- CUACACGACGCUCUUCCGAUCU[6-bp UMI]rGrGrG -3'

DI-PCR-P1A: 5'-Bio- AATGATACGGCGACCACCGA -3'

DI-P1A-idx[1-32]-P1B: 5'-Bio- AATGATACGGCGACCACCGAGATCTACAC[5-bp well barcode]CTACACGACGCTCTTCCGATC -3'

Barcoded STRT-Tn5-Idx[1-96] top (including 19-bp Mosaic End (ME)): 5'- CAAGCAGAAGACGGCATACGA[8-bp subarray barcode]GCGTCAGATGTGTATAAGAGACAG -3'

Universal Tn5 bottom (STRT-TN5-U): 5'- CTGTCTCTTATACACATCTGACGC -3'

Annealed Tn5 oligos for Tn5 transposome assembly:

5'- CAAGCAGAAGACGGCATACGA[8-bp subarray barcode]GCGTCAGATGTGTATAAGAGACAG -3'
                                                      3'- TCTACACATATTCTCTGTC -5'

*P1_2nd_PCR: 5'- AATGATACGGCGACCACCGAGATC -3'

*P2_2nd_PCR: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

DI-Read1-Seq: 5'- ATGATACGGCGACCACCGAGATCTACACNNNNNNCTACACGACGCTCTTCCGATCT -3'

DI_idxP1A-Seq: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

* Recent sequencing libraries use Illumina P5/P7 adapters, instead of Solexa P1/P2 adapters.



Step-by-step library generation

(1) Anneal C1-P1-T31 to mRNA and reverse transcription using MMLV:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
                 <----NV(T)31GCTAGCCACCAGCGGCATAGTAA -Bio-5'

(2) After reverse transcription, the terminal tranferase acitivity of MMLV add extra Cs:


5'- XXXXXXXXXXXXXXXXXXXB(A)n
 CCCXXXXXXXXXXXXXXXXXXNV(T)31GCTAGCCACCAGCGGCATAGTAA -Bio-5'

(3) Adding P1B-UMI-RNA-TSO for second strand synthesis:


5'-Bio- CUACACGACGCUCUUCCGAUCU[6-bp UMI]GGGXXXXXXXXXXXXXXXXXXXX(A)n
                                        CCCXXXXXXXXXXXXXXXXXXXX(T)31GCTAGCCACCAGCGGCATAGTAA -Bio-5'

(4) cDNA amplification using single DI-PCR-P1A and DI-P1A-idx[1-32]-P1B primers to index the wells within each subarray:


5'-Bio- AATGATACGGCGACCACCGAGATCTACAC[5-bp well barcode]CTACACGACGCTCTTCCGATC---->
                                               5'-Bio-  CUACACGACGCUCUUCCGAUCU[6-bp UMI]GGGXXXXX...XXXXXX(pA)CGATCGGTGGTCGCCGTATCATT
                                                        GATGTGCTGCGAGAAGGCTAGA[6-bp UMI]CCCXXXXX...XXXXXX(dT)GCTAGCCACCAGCGGCATAGTAA -Bio-5'
                                                                                                           <----AGCCACCAGCGGCATAGTAA -Bio-5'

(5) Amplified double stranded and indexed cDNA looks like this:


5'-Bio- AATGATACGGCGACCACCGAGATCTACAC[5-bp well barcode]CTACACGACGCTCTTCCGATCT[6-bp UMI]GGGXXX...XXX(pA)CGATCGGTGGTCGCCGTATCATT
        TTACTATGCCGCTGGTGGCTCTAGATGTG[5-bp well barcode]GATGTGCTGCGAGAAGGCTAGA[6-bp UMI]CCCXXX...XXX(dT)GCTAGCCACCAGCGGCATAGTAA -Bio-5'

(6) Homemade Tn5 homodimers using annealed Barcoded STRT-Tn5-Idx[1-96] top/bottom tagmentation on amplified cDNA (will create 9-bp gap):

Tn5 strt seq 2i

Product 1 (5'-end of cDNA):

5'-Bio- AATGATACGGCGACCACCGAGATCTACAC[5-bp well barcode]CTACACGACGCTCTTCCGATCT[6-bp UMI]GGGXXX...XXX         CTGTCTCTTATACACATCT
        TTACTATGCCGCTGGTGGCTCTAGATGTG[5-bp well barcode]GATGTGCTGCGAGAAGGCTAGA[6-bp UMI]CCCXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp subarray barcode]AGCATACGGCAGAAGACGAAC -5'



Product 2 (3'-end of cDNA): 5'-Bio- AATGATACGGCGACCACCGATCG(dT)XXX...XXX CTGTCTCTTATACACATCT TTACTATGCCGCTGGTGGCTAGC(pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp subarray barcode]AGCATACGGCAGAAGACGAAC -5'


(7) Streptavidin binding and PvuI digestion (5'...CGATCG...3'):


Product 1 (5'-end of cDNA) will not be affected:

|--5'-Bio- AATGATACGGCGACCACCGAGATCTACAC[5-bp well barcode]CTACACGACGCTCTTCCGATCT[6-bp UMI]GGGXXX...XXXCTGTCTCTTATACACATCTGACGC[8-bp subarray barcode]TCGTATGCCGTCTTCTGCTTG
           TTACTATGCCGCTGGTGGCTCTAGATGTG[5-bp well barcode]GATGTGCTGCGAGAAGGCTAGA[6-bp UMI]CCCXXX...XXXGACAGAGAATATGTGTAGACTGCG[8-bp subarray barcode]AGCATACGGCAGAAGACGAAC -5'



Product 2 (3'-end of cDNA) will be cut by PvuI (this product is omitted later since it cannot be amplified): |--5'-Bio- AATGATACGGCGACCACCGAT CG(dT)XXX...XXX CTGTCTCTTATACACATCT TTACTATGCCGCTGGTGGC TAGC(pA)XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCG[8-bp subarray barcode]AGCATACGGCAGAAGACGAAC -5'


(8) Library amplification using P1_2nd_PCR and P2_2nd_PCR priers:


       5'- AATGATACGGCGACCACCGAGATC-------->
|--5'-Bio- AATGATACGGCGACCACCGAGATCTACAC[5-bp well barcode]CTACACGACGCTCTTCCGATCT[6-bp UMI]GGGXXX...XXXCTGTCTCTTATACACATCTGACGC[8-bp subarray barcode]TCGTATGCCGTCTTCTGCTTG
           TTACTATGCCGCTGGTGGCTCTAGATGTG[5-bp well barcode]GATGTGCTGCGAGAAGGCTAGA[6-bp UMI]CCCXXX...XXXGACAGAGAATATGTGTAGACTGCG[8-bp subarray barcode]AGCATACGGCAGAAGACGAAC -5'
                                                                                                                                         <---------TAGAGCATACGGCAGAAGACGAAC -5'

(9) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNCTACACGACGCTCTTCCGATCTNNNNNNGGGXXX...XXXCTGTCTCTTATACACATCTGACGCNNNNNNNNTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNGATGTGCTGCGAGAAGGCTAGANNNNNNCCCXXX...XXXGACAGAGAATATGTGTAGACTGCGNNNNNNNNAGCATACGGCAGAAGACGAAC -5'
        Solexa P1                 5bp                        UMI       cDNA           ME                 8bp         Solexa P2
                                  well                                                                 subarray
                                barcode                                                                barcode



Library sequencing:

(1) Add DI-Read1-Seq sequencing primer to sequence the first read (bottom strand as template, the first 6-bp of the read will be UMI):


5'-  ATGATACGGCGACCACCGAGATCTACACNNNNNCTACACGACGCTCTTCCGATCT-------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNGATGTGCTGCGAGAAGGCTAGANNNNNNCCCXXX...XXXGACAGAGAATATGTGTAGACTGCGNNNNNNNNAGCATACGGCAGAAGACGAAC -5'

(2) Add STRT-Tn5-U primer to sequence subarray barcodes (bottom strand as template):


                                                                          5'- CTGTCTCTTATACACATCTGACGC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNGATGTGCTGCGAGAAGGCTAGANNNNNNCCCXXX...XXXGACAGAGAATATGTGTAGACTGCGNNNNNNNNAGCATACGGCAGAAGACGAAC -5'

(3) Add DI_idxP1A-Seq primer to sequence well barcodes (bottom strand as template):


5'- AATGATACGGCGACCACCGAGATCTACAC---->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNGATGTGCTGCGAGAAGGCTAGANNNNNNCCCXXX...XXXGACAGAGAATATGTGTAGACTGCGNNNNNNNNAGCATACGGCAGAAGACGAAC -5'