Quartz-seq / Quartz-seq2

The detailed step-by-step experimental protocols of Quartz-seq and Quartz-seq2 can be found at the RIKEN's website. Quartz-seq cosntructs the library of each single cell spearately, so it has low plexity. The indices are from Illumina Truseq adapters. The presence of T7 promoter sequence is only for Quartz-chip. Quartz-seq2 increased the throughput by using barcoded RT primer (1536 barcoded RT primers) to profile 3' end of cDNA. The cell barcode sequence can be found here.



Quartz-seq

Adapter and primer sequences:

RT primer (WTA): 5'- TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT -3'

Tagging primer: 5'- TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT -3'

Suppression primer: 5′- (NH2)-GTATAGAATTCGCGGCCGCTCGCGAT -3′

TRSU: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T -3'

TRSI (indexed oligo): 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTT*G -3'

Prepare indexed Truseq adapters by annealing TRSU and TRSI (formed the Y-shaped adapters):


	   5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC
			                                    GCTCTTCCGATC*T -3'
	                                                    CGAGAAGGCTAG
    3'- G*TTCGTCTTCTGCCGTATGCTCTANNNNNNCACTGACCTCAAGTCTGCACA

TPC1: 5'- AATGATACGGCGACCACCGA*G -3'

TPC2: 5'- CAAGCAGAAGACGGCATACGA*G -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

TruSeq Read 1 sequencing primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Index 1 sequencing primer: 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

TruSeq Read 2 sequencing primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'



Step-by-step library generation

(1) Anneal RT primer to mRNA and reverse transcription using SuperScript III:


5'- XXXXXXXXXXXXXXXXXX(A)n
                 <----(T)24GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

(2) Products after reverse transcription:


 1. RT product (DNA-RNA hybrid):

5'- XXXXXXXXXXXXXXXXXXXXX(A)n
    XXXXXXXXXXXXXXXXXXXXX(T)24GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

 2. RT primer leftover:

3'- (T)24GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

(3) RNaseH and Poly-A tailing reaction (not sure how many 'A's will be added):


 1. From RT product:

3'- (pA)XXXXXXXXXXXXXXXXXXXXX(T)24GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

 2. From RT primer leftover:

3'- (pA)(T)24GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

(4) Add Tagging primer for second strand synthesis:


 1. From RT product:

5'- TATAGAATTCGCGGCCGCTCGCGA(T)24---------->
                <----------(pA)XXXXXXXXXXXXXXXXXXXXX(dT)24GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

 2. From RT primer leftover:

5'- TATAGAATTCGCGGCCGCTCGCGA(T)24---------->
                <----------(pA)(T)24GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

(5) Products after second strand synthesis:


 1. From RT product (amplifiable, see the next step):

5'- TATAGAATTCGCGGCCGCTCGCGA(dT)XXXXX...XXXXX(pA)CGCCCTATAGTGAGTCGTATTATCGCGAGCGGCCGCGAATTCTATA
    ATATCTTAAGCGCCGGCGAGCGCT(pA)XXXXX...XXXXX(dT)GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

 2. From RT primer leftover (not amplifiable due to semi-suppressive PCR, omitted in the next step):

5'- TATAGAATTCGCGGCCGCTCGCGA(dT)(pA)CGCCCTATAGTGAGTCGTATTATCGCGAGCGGCCGCGAATTCTATA
    ATATCTTAAGCGCCGGCGAGCGCT(pA)(dT)GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'

(6) Adding Suppression primer for single primer cDNA amplification:( i.e. semi-suppressive PCR )


5′- (NH2)-GTATAGAATTCGCGGCCGCTCGCGAT---------->
       5'- TATAGAATTCGCGGCCGCTCGCGA(dT)XXXXX...XXXXX(pA)CGCCCTATAGTGAGTCGTATTATCGCGAGCGGCCGCGAATTCTATA
           ATATCTTAAGCGCCGGCGAGCGCT(pA)XXXXX...XXXXX(dT)GCGGGATATCACTCAGCATAATAGCGCTCGCCGGCGCTTAAGATAT -5'
					                           <---------TAGCGCTCGCCGGCGCTTAAGATATG-(NH2) -5'

(7) cDNA Fragmentation, end repair and A-tailing:


Product 1 (left end plus cDNA, cannot be fully ligated due to 5' blocked by NH2, omitted in the next step):

5'- (NH2)-GTATAGAATTCGCGGCCGCTCGCGA(dT)XXXXX...XXXXXA -3'
3'-      ACATATCTTAAGCGCCGGCGAGCGCT(pA)XXXXX...XXXXX  -5'


Product 2 (right end plus cDNA, cannot be fully ligated due to 5' blocked by NH2, omitted in the next step):

5'- (NH2)-GTATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCG(dT)XXXXX...XXXXXA -3'
3'-      ACATATCTTAAGCGCCGGCGAGCGCTATTATGCTGAGTGATATCCCGC(pA)XXXXX...XXXXX  -5'


Product 3 (middle of cDNA, can be fully ligated, hence only sequence-able fragments):

5'-  XXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXA -3'
3'- AXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXX  -5'

(8) Add TruSeq Indexed adapters for ligation:


      5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC                                                   ACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
	                                               GCTCTTCCGATCTXXXXXXXXXXX...XXXXXXXXXXXAGATCGGAAGAGC
						       CGAGAAGGCTAGAXXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCG
3'- GTTCGTCTTCTGCCGTATGCTCTANNNNNNCACTGACCTCAAGTCTGCACA                                                   CAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA -5'

(9) Amplification using TPC1 and TPC2 primers:


Top strand will be amplified like this: 

5'- AATGATACGGCGACCACCGAG---------->
5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXXXXXXX...XXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                                      <----------GAGCATACGGCAGAAGACGAAC -5'

Bottom strand will be amplified like this: 

5'- CAAGCAGAAGACGGCATACGAGAT---------->
3'- GTTCGTCTTCTGCCGTATGCTCTANNNNNNCACTGACCTCAAGTCTGCACACGAGAAGGCTAGAXXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA -5'
                                                                                                                       <----------GAGCCACCAGCGGCATAGTAA -5'

(10) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXXXXXXX...XXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5                TruSeq Read 1                      cDNA                      TruSeq Read 2          cell       Illumina P7
		                                                                                                          index



Library sequencing:

(1) Add TruSeq Read 1 sequencing primer to sequence the first read (bottom strand as template):


                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT---------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index 1 sequencing primer to sequence the sample index (bottom strand as template):


                                                                                    5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add TruSeq Read 2 sequencing primer to sequence the second read (top strand as template):


5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXXXXXXX...XXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                            <----------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG



Quartz-seq2

Adapter and primer sequences:

eMDRT0001 - eMDRT1536: 5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTT

Tagging primer: 5'- TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT -3'

gM primer (the same as Suppression primer in Quartz-seq): 5′- GTATAGAATTCGCGGCCGCTCGCGAT -3′

rYshapeP5: 5'- GATCGGAAGAGCGTCGTGTA -3'

rYshapeP7LT (Sample Index Oligos): 5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Prepare truncated sequence adapter indexed Truseq adapters by annealing rYshapeP5 and rYshapeP7LT:


5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'
                                                                    CGAGAAGGCTAG -5'
                                                        3'- ATGTGCTG

P5-gMac_hybrid: 5'- AATGATACGGCGACCACCGAGATCTACATTGTATAGAATTCGCGGCCGCTCGCGATAC -3'

TPC2: 5'- CAAGCAGAAGACGGCATACGA*G -3'

Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Read1DropQuartz primer: 5'- ACATTGTATAGAATTCGCGGCCGCTCGCGATAC -3'

Index 1 sequencing primer: 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

TruSeq Read 2 sequencing primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'



Step-by-step library generation

(1) Anneal eMDRT primer to mRNA and reverse transcription using SuperScript III:


5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](T)24---------->
                                                             (A)nXXXXXXXXXXXXXXXXXXXXX -5'

(2) Products after reverse transcription:


 1. RT product (DNA-RNA hybrid):

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXXXXXXXXXXXXXXXXXX
                                                             (pA)XXXXXXXXXXXXXXXXXXXXX -5'

 2. RT primer leftover:

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT) -3'

(3) RNaseH and Poly-A tailing reaction (not sure how many 'A's will be added):


 1. From RT product:

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXXXXXXXXXXXXXXXXXX(pA) -3'

 2. From RT primer leftover:

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)(pA) -3'

(4) Add Tagging primer for second strand synthesis:


 1. From RT product:

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXX...XXXXX(pA)---------->
                                                                   <----------(dT)AGCGCTCGCCGGCGCTTAAGATAT -5'
 2. From RT primer leftover:

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)(pA)---------->
                                                      <----------(dT)AGCGCTCGCCGGCGCTTAAGATAT -5'

(5) Products after second strand synthesis:


 1. From RT product (amplifiable, see the next step):

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXX...XXXXX(pA)TCGCGAGCGGCCGCGAATTCTATA
    ATATCTTAAGCGCCGGCGAGCGCTATG[15-bp cell barcode][8-bp UMI](pA)XXXXX...XXXXX(dT)AGCGCTCGCCGGCGCTTAAGATAT -5'


 2. From RT primer leftover (not amplifiable due to semi-suppressive PCR, omitted in the next step):

5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)(pA)TCGCGAGCGGCCGCGAATTCTATA
    ATATCTTAAGCGCCGGCGAGCGCTATG[15-bp cell barcode][8-bp UMI](pA)(dT)AGCGCTCGCCGGCGCTTAAGATAT -5'

(6) Adding gM primer for single primer cDNA amplification:( i.e. semi-suppressive PCR )


5′- GTATAGAATTCGCGGCCGCTCGCGAT---------->
 5'- TATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXX...XXXXX(pA)TCGCGAGCGGCCGCGAATTCTATA
     ATATCTTAAGCGCCGGCGAGCGCTATG[15-bp cell barcode][8-bp UMI](pA)XXXXX...XXXXX(dT)AGCGCTCGCCGGCGCTTAAGATAT -5'
					                                <---------TAGCGCTCGCCGGCGCTTAAGATATG -5'

(7) cDNA Fragmentation, end repair and A-tailing:


Product 1 (eMDRT plus 3'-end of cDNA):

5'- GTATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXX...XXXXXA
   ACATATCTTAAGCGCCGGCGAGCGCTATG[15-bp cell barcode][8-bp UMI](pA)XXXXX...XXXXX -5'


Product 2 (Tagging primer plus 5'-end cDNA):

5'- GTATAGAATTCGCGGCCGCTCGCGA(dT)XXXXX...XXXXXA -3'
   ACATATCTTAAGCGCCGGCGAGCGCT(pA)XXXXX...XXXXX  -5'


Product 3 (middle of cDNA):

5'-  XXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXA -3'
3'- AXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXX  -5'

(8) Add Truncated sequence adapters for ligation:

Product 1 (eMDRT plus 3'-end of cDNA, the only amplifiable fragments, see the next step)


                                                                                                                                                                         GTCGTGTA
5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXX...XXXXXAGATCGGAAGAGC
                                                                    CGAGAAGGCTAGACATATCTTAAGCGCCGGCGAGCGCTATG[15-bp cell barcode][8-bp UMI](pA)XXXXX...XXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'
                                                            ATGTGCTG



Product 2 (Tagging primer plus 5'-end cDNA, cannot be amplified due to primers used, see the next step clarification)


                                                                                                                                        GTCGTGTA
5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTATAGAATTCGCGGCCGCTCGCGA(dT)XXXXX...XXXXXAGATCGGAAGAGC
                                                                    CGAGAAGGCTAGACATATCTTAAGCGCCGGCGAGCGCT(pA)XXXXX...XXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'
                                                            ATGTGCTG



Product 3 (middle of cDNA, cannot be amplified due to primers used, omitted in the next step)


                                                                                                                               GTCGTGTA
5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXAGATCGGAAGAGC
                                                                    CGAGAAGGCTAGAXXXXXXXXXXXXXXX...XXXXXXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'
                                                            ATGTGCTG



(9) Amplification using P5-gMac_hybrid and TPC2 primers:


Product 1 (eMDRT plus 3'-end of cDNA) will be amplified like this: 



                                               5'- AATGATACGGCGACCACCGAGATCTACAT
                                                                                TGTATAGAATTCGCGGCCGCTCGCGATAC---------->                                                 GTCGTGTA
5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTATAGAATTCGCGGCCGCTCGCGATAC[15-bp cell barcode][8-bp UMI](dT)XXXXX...XXXXXAGATCGGAAGAGC
                                                                    CGAGAAGGCTAGACATATCTTAAGCGCCGGCGAGCGCTATG[15-bp cell barcode][8-bp UMI](pA)XXXXX...XXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'                
                                                            ATGTGCTG                                                                                                                                    <----------GAGCATACGGCAGAAGACGAAC -5'


Product 2 (Tagging primer plus 5'-end cDNA) cannot be amplified, note the P5-gMac primer ends with "AC" which will not anneal to the template:



                                               5'- AATGATACGGCGACCACCGAGATCTACAT
                                                                                TGTATAGAATTCGCGGCCGCTCGCGATAC                           GTCGTGTA
5'- CAAGCAGAAGACGGCATACGAGAT[6-bp sample index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTATAGAATTCGCGGCCGCTCGCGA(dT)XXXXX...XXXXXAGATCGGAAGAGC
                                                                    CGAGAAGGCTAGACATATCTTAAGCGCCGGCGAGCGCT(pA)XXXXX...XXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[6-bp sample index]TAGAGCATACGGCAGAAGACGAAC -5'	                
                                                            ATGTGCTG                                                                                                              GAGCATACGGCAGAAGACGAAC -5'


(10) Final library structure:


5'- AATGATACGGCGACCACCGAGATCTACATTGTATAGAATTCGCGGCCGCTCGCGATACNNNNNNNNNNNNNNNNNNNNNNN(dT)XXXXXXXXXXX...XXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTAACATATCTTAAGCGCCGGCGAGCGCTATGNNNNNNNNNNNNNNNNNNNNNNN(pA)XXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5                                             15-bp     8bp UMI               cDNA                      TruSeq Read 2            6bp       Illumina P7
		                                               cell barcode                                                                      sample index



Library sequencing:

(1) Read1DropQuartz primer to sequence the first read (bottom strand as template, 23 cycles, this is the cell barcode and UMI):


                         5'- ACATTGTATAGAATTCGCGGCCGCTCGCGATAC---------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTAACATATCTTAAGCGCCGGCGAGCGCTATGNNNNNNNNNNNNNNNNNNNNNNN(pA)XXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Index 1 sequencing primer to sequence the sample index (bottom strand as template):


                                                                                                               5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC----->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTAACATATCTTAAGCGCCGGCGAGCGCTATGNNNNNNNNNNNNNNNNNNNNNNN(pA)XXXXXXXXXXX...XXXXXXXXXXXTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add TruSeq Read 2 sequencing primer to sequence the second read (top strand as template, this is the cDNA read):


5'- AATGATACGGCGACCACCGAGATCTACATTGTATAGAATTCGCGGCCGCTCGCGATACNNNNNNNNNNNNNNNNNNNNNNN(dT)XXXXXXXXXXX...XXXXXXXXXXXAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                       <----------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG