ISSAAC-seq FACS (in plates) / ISSAAC-seq Droplet

ISSAAC-seq (In Situ SHERRY After ATAC-seq) is a multiomics technique that performs ATAC and RNA from the same cells. It combines SHERRY and ATAC in situ, followed by single nulcei isolation and library preparation. There are two workflows: FACS and Droplet. The sequence design of FACS and Droplet workflows is extermely similar.



ISSAAC-seq FACS

Adapter and primer sequences:

TruseqR1_oligo_dT: 5'- CTACACGACGCTCTTCCGATCT[10-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Nextera N/S5xx Index primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]TCGTCGGCAGCGTC -3'

Nextera N7xx Index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Truseq P5 PCR index primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Truseq Read 1 sequencing primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

Nextera Read 1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Nextera i7 sequencing primer (index1): 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Nextera i5 sequencing primer (index2, ATAC): 5'- CTGTCTCTTATACACATCTGACGCTGCCGACGA -3'

Truseq i5 sequencing primer (index2, RNA): 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -3'

Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'



Step-by-step library generation

(1) Perform tagmentation on nuclei with normal Tn5 s5/s7 dimer:

Tn5 dimer


chromatin DNA:

  Product 1 (s5 at both ends, not amplifiable due to semi-suppressive PCR, will be ommitted):

    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                      TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


  Product 2 (s7 at both ends, not amplifiable due to semi-suppressive PCR, will be ommitted):

    5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                       TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


  Product 3 (different ends, amplifiable):

    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                      TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA (unchanged):

    AAAAA......AAAAAXXXXXXXXXXXXXXXXXXXXX -5'

(2) in situ reverse transcription:



chromatin DNA:

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                    TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

  5'- CTACACGACGCTCTTCCGATCT[10-bp UMI](dT)VN------>
                                       (pA)BXXXXXXXXXXXX...XXXXXXXXXXXX -5'

  Product after reverse transciption:

  5'- CTACACGACGCTCTTCCGATCT[10-bp UMI](dT)VXXXXXXXXXXXX...XXXXXXXXXXXX -3'
  3'- GATGTGCTGCGAGAAGGCTAGA[10-bp UMI](pA)BXXXXXXXXXXXX...XXXXXXXXXXXX -5'

(3) Second tagmentation using Tn5 s7 homodimer to cut the RT product (DNA/RNA hybrid):

Tn5 dimer


chromatin DNA (should be minimally affected):

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                    TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

   Product 1 (inner part of mRNA, not amplifiable due to semi-suppressiev PCR, will be ommitted):

      5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                         TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

   Product 2 (3' of mRNA, amplifiable):

      5'- CTACACGACGCTCTTCCGATCT[10-bp UMI](dT)VXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
      3'- GATGTGCTGCGAGAAGGCTAGA[10-bp UMI](pA)BXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(4) Gap fill-in and oligo leftover removal by Exo I:


chromatin DNA:

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
      AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

  5'- CTACACGACGCTCTTCCGATCT[10-bp UMI](dT)VXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
  3'- GATGTGCTGCGAGAAGGCTAGA[10-bp UMI](pA)BXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

(5) Adding Nextera N7xx, S5xx and Truseq P5 PCR index primer for library preparation (three primers, independent amplification):



chromatin DNA:

5'- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC---->
                                 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
                                     AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                             <----GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT---->
                                            5'- CTACACGACGCTCTTCCGATCT[10-bp UMI](dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
                                                GATGTGCTGCGAGAAGGCTAGA[10-bp UMI](pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                                             <----GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(6) Final library structure:

Chromatin DNA (chromatin accessibility):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXX...XXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5              i5         s5              ME                gDNA                ME               s7          i7            Illumina P7

mRNA (gene expression):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNN(dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNN(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5               i5             Truseq Read 1            10 bp          cDNA            ME             s7           i7        Illumina P7
                                                                             UMI



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template):

Chromatin DNA (chromatin accessibility):


                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG---------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

mRNA (gene expression):


                                     5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNN(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Nextera i7 sequencing primer (index1) to sequence the first index (i7) (bottom strand as template, this is the well barcode):

Chromatin DNA (chromatin accessibility):


                                                                                         5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC---------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXX...XXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

mRNA (gene expression):


                                                                                              5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC--------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNN(pA)BXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, add Nextera/Truseq i5 sequeuncing primer to sequence the second index (i5) (top strand as template, this is the plate barcodes and tell the difference between RNA and ATAC):

Chromatin DNA (chromatin accessibility):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXX...XXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                 <-------AGCAGCCGTCGCAGTCTACACATATTCTCTGTC -5'

mRNA (gene expression):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNN(dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                 <-------TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA -5'

(4) Add read 2 sequencing primer to sequence the second read (top strand as template):

Chromatin DNA (chromatin accessibility):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXX...XXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                     <-------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

mRNA (gene expression):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNN(dT)VXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                          <-------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'



ISSAAC-seq Droplet

Adapter and primer sequences:

10x Single Cell ATAC beads: |--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTC -3'

TruseqR2_oligo_dT: 5'- CAGACGTGTGCTCTTCCGATCT[10-bp UMI]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN

Nextera Tn5 binding site (19-bp Mosaic End (ME)): 5'- AGATGTGTATAAGAGACAG -3'

Nextera N/S5xx primer entry point (s5): 5'- TCGTCGGCAGCGTC -3'

Nextera N7xx primer entry point (s7): 5'- GTCTCGTGGGCTCGG -3'

Nextera N/S5xx Index primer: 5'- AATGATACGGCGACCACCGAGATCTACAC[8-bp i5 index]TCGTCGGCAGCGTC -3'

Nextera N7xx Index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTCTCGTGGGCTCGG -3'

Truseq P7 PCR index primer: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp i7 index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

Nextera Read 1 sequencing primer: 5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3'

Nextera i7 sequencing primer (index1, ATAC): 5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3'

Truseq i7 sequencing primer(index1, RNA): 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'

Nextera i5 sequencing primer (index2): 5'- CTGTCTCTTATACACATCTGACGCTGCCGACGA -3'

Nextera Read 2 sequencing primer: 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG -3'

Truseq Read 2 sequencing primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'



Step-by-step library generation

(1) Perform tagmentation on nuclei with normal Tn5 s5/s7 dimer:

Tn5 dimer


chromatin DNA:

  Product 1 (s5 at both ends, not amplifiable due to semi-suppressive PCR, will be ommitted):

    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                      TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'


  Product 2 (s7 at both ends, not amplifiable due to semi-suppressive PCR, will be ommitted):

    5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                       TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


  Product 3 (different ends, amplifiable):

    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                      TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA (unchanged):

    5'- XXXXXXXXXXXX...XXXXXXXXXXXXAAAAAA...AAAAAA

(2) in situ reverse transcription:



chromatin DNA:

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                    TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

  5'- XXXXXXXXXXXX...XXXXXXXXXXXXB(pA)
                   <-------------V(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

  Product after reverse transcription:

  5'- XXXXXXXXXXXX...XXXXXXXXXXXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTG
      XXXXXXXXXXXX...XXXXXXXXXXXXV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(3) Second tagmentation using Tn5 s5 homodimer to cut the RT product (DNA/RNA hybrid):

Tn5 dimer


chromatin DNA (should be minimally affected):

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                    TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

   Product 1 (inner part of mRNA, not amplifiable due to semi-suppressiev PCR, will be ommitted):

      5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXX         CTGTCTCTTATACACATCT
                        TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGACTGCGACGGCTGCT -5'

   Product 2 (3' of mRNA, amplifiable):

      5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTG
                        TCTACACATATTCTCTGTC         XXX...XXXXXXXXXXXXV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(4) Gap fill-in and oligo leftover removal by Exo I:


chromatin DNA:

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
      AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

  5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXXXXXXXXXXX...XXXXXXXXXXXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTG
      AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXXXXXXXXXXX...XXXXXXXXXXXXV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(5) Put onto the 10X Chromium for Droplet capture on the beads (12 cycles of linear PCR)


chromatin DNA:

|--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTC--------------->
                                                    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
                                                        AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

|--5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTC--------------->
                                                    5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTG
                                                        AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(6) Break emulsion and purify the pre-amplified products:


chromatin DNA:

5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
    TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTG
    TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'

(7) Adding Illumina P5, Nextera N7xx and Truseq P7 PCR index primer for library preparation (three primers, independent amplification, or separate amplification):



chromatin DNA:

5'- AATGATACGGCGACCACCGAGATCTACAC-------------------->
5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGAC
    TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'
                                                                                             <--------------------GGCTCGGGTGCTCTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'


mRNA:

5'- AATGATACGGCGACCACCGAGATCTACAC-------------------->
5'- AATGATACGGCGACCACCGAGATCTACAC[16-bp cell barcode]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)[10-bp UMI]AGATCGGAAGAGCACACGTCTG
    TTACTATGCCGCTGGTGGCTCTAGATGTG[16-bp cell barcode]AGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)[10-bp UMI]TCTAGCCTTCTCGTGTGCAGAC -5'
                                                                                                          <----TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG[i7]TAGAGCATACGGCAGAAGACGAAC -5'

(8) Final library structure:

Chromatin DNA (chromatin accessibility):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5                 16 bp          s5              ME            gDNA           ME               s7          i7            Illumina P7
                                   cell barcode

mRNA (gene expression):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)NNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5                  16 bp          s5              ME            cDNA           10 bp             Truseq Read 2             i7        Illumina P7
                                   cell barcode                                                     UMI



Library sequencing:

(1) Add read 1 sequencing primer to sequence the first read (bottom strand as template):

Chromatin DNA (chromatin accessibility):


                                             5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

mRNA (gene expression):


                                             5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)NNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(2) Add Nextera/Truseq i7 sequencing primer to sequence the index1 (i7) (bottom strand as template, this is the sample index and tells the difference between RNA and ATAC):

Chromatin DNA (chromatin accessibility):


                                                                                       5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXGACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

mRNA (gene expression):


                                                                                                       5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTCXXX...XXXV(dT)NNNNNNNNNNTCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

(3) Cluster regeneration, and add Nextera i5 sequencing primer to sequence the index2 (i5) (top strand as template, this is the 10x cell barcodes, 16 cycles):

<

Chromatin DNA (chromatin accessibility):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                 <---------------AGCAGCCGTCGCAGTCTACACATATTCTCTGTC -5'

mRNA (gene expression):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                 <---------------AGCAGCCGTCGCAGTCTACACATATTCTCTGTC -5'

(4) Add Nextera/Trsueq Read 2 sequencing primer to sequence the second read (top strand as template, in the RNA library, the first 10 bp are UMIs):

Chromatin DNA (chromatin accessibility):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXCTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                 <---------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

mRNA (gene expression):


5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGXXX...XXXB(pA)NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                                <---------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'