
Drop-ChIP was pulished in Nature Biotechnology 33, 165–1172 (2015), by Assaf Rotem, Oren Ram and Noam Shoresh in the labs of David Weitz and Bradely Bernstein. This page will only demonstrate the molecular biology of library construction. To look at the real equipment and how the experiments were carried out, see the Supplementary Information from the original publication and the Drop-ChIP webpage.

Adapter and primer sequences:

Barcoded adapters (BA). These are double stranded DNA and there are 1,152 of them. Click here to see all of them:

    half  BC    BciVI           PacI           BciVI  BC    half
    PacI                                                    PacI

*Illumina Truseq forked adapters:

                                                         GCTCTTCCGATCT -3'
                                                         CGAGAAGGCTAGp -5'

Other adapters/primers used:



Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'


Sample Index sequencing primer: 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'


Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

* It was not entirely clear what adapters were used in the protocol. These are educational guess, not confirmed!!! However, based on the sequenicng data, these are likely to be the case. See the sequence immediately after the 'grep'ed sequence, one of them (GATCGGAAGAGCACA...) that's Truseq adapters (the others are probably bacoded adapters (BA) concatemers):

grep sequence

Step-by-step library generation:

(1) MNase digestion to fragment DNA, end repair, and blunt ligation of BA in the droplet:

Product 1 (BA at both ends of genomic DNA, these have four possibilities based on the orientation of BAs):

Orientation 1:
    half   BC   BciVI           PacI           BciVI   BC   half genomic half   BC    BciVI          PacI          BciVI    BC   half
    PacI                                                    PacI   DNA   PacI                                                    PacI

Orientation 2:
    half   BC   BciVI           PacI           BciVI   BC   half genomic half   BC    BciVI          PacI          BciVI    BC   half
    PacI                                                    PacI   DNA   PacI                                                    PacI

Orientation 3:
    half   BC   BciVI           PacI           BciVI   BC   half genomic half   BC    BciVI          PacI          BciVI    BC   half
    PacI                                                    PacI   DNA   PacI                                                    PacI

Orientation 4:
    half   BC   BciVI           PacI           BciVI   BC   half genomic half   BC    BciVI          PacI          BciVI    BC   half
    PacI                                                    PacI   DNA   PacI                                                    PacI

Product 2 (BA self concatemers):

    half   BC   BciVI           PacI           BciVI   BC     PacI     BC   BciVI           PacI          BciVI    BC   half
    PacI                                                                                                                PacI

Product 3: BA is ligated to only one end genomic DNA (not amplifiable, not drawn here)

Product 4: single or multiple BAs are ligated to genomic DNA and form a circular DNA (not drawn here, see Figure 3a from the original publication)

(2) Merge drops, immunoprecipitation (IP), wash IP, and PacI digestion

Product 1 (four orientation, amplifiable):

Orientation 1:

Orientation 2:

Orientation 3:

Orientation 4:

Product 2 (chopped into pieces, not amplifiable):


(3) Elution, DNA purification, adding SC-PCR1 and SC-PCR2 for pre-amplifcation:

Orientation 1:

                                                 <------CATAGGCCCCCTGGAAT -5'

Orientation 2 (the same adapter at both ends, may not be amplified efficiently due to suppressive PCR):

                                                 <------CATAGGGGGGGTGGAAT -5'

Orientation 3 (the same adapter at both ends, may not be amplified efficiently due to suppressive PCR):

                                                 <------CATAGGCCCCCTGGAAT -5'
Orientation 4:

                                                 <------CATAGGGGGGGTGGAAT -5'

(4) DNA purification, and BciVI digestion, resulting in A overhang:

Orientation 1 pre-amplification product:


Orientation 2 pre-amplification product:


Orientation 3 pre-amplification product:


Orientation 4 pre-amplification product:


(5) DNA purification, and ligate Illumina forked adpters:

Orientation 1


Orientation 2


Orientation 3


Orientation 4


(6) DNA purfication --> PacI digestion --> DNA purfication --> and adding Illumina P5 & P7 adapters for library amplification (use top strand as demonstration here):

Orientation 1

Orientation 2

Orientation 3

Orientation 4


(7) Final library structure:

Orientation 1


Orientation 2


Orientation 3


Orientation 4

           Illumina P5                  Truseq read 1              BciVI   Cell       Genomic       Cell  BciVI                 Truseq read 2           sample        Illumina P7
                                                                          barcode       DNA        barcode                                              index

Library sequencing (three steps):

(1) Add Truseq Read 1 sequencing primer to sequence the first read (bottom strand as template, first 11 cycles are dark cycles):

Orientation 1

                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT___________----------------------->

Orientation 2

                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT___________----------------------->

Orientation 3

                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT___________----------------------->

Orientation 4

                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT___________----------------------->

(2) Add Sample Index sequencing primer to sequence sample index (bottom strand as template):

Orientation 1

                                                                                                                 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->

Orientation 2

                                                                                                                 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->

Orientation 3

                                                                                                                 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->

Orientation 4

                                                                                                                 5'- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->

(3) Cluster regeneration, and add Truseq Read 2 sequencing primer to sequence read 2 (top strand as template, first 11 cycles are dark cycles):

Orientation 1

                                                                                   <----------------------___________TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

Orientation 2

                                                                                   <----------------------___________TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

Orientation 3

                                                                                   <----------------------___________TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

Orientation 4

                                                                                   <----------------------___________TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'